ID: 1191620395

View in Genome Browser
Species Human (GRCh38)
Location X:63209992-63210014
Sequence GCCCCTGAGAGAAGGGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191620395_1191620401 5 Left 1191620395 X:63209992-63210014 CCTGTCCCCCTTCTCTCAGGGGC No data
Right 1191620401 X:63210020-63210042 ACTCCACAGGATAGATTGTCAGG No data
1191620395_1191620405 23 Left 1191620395 X:63209992-63210014 CCTGTCCCCCTTCTCTCAGGGGC No data
Right 1191620405 X:63210038-63210060 TCAGGGGTCACACAGCTTCCTGG No data
1191620395_1191620408 30 Left 1191620395 X:63209992-63210014 CCTGTCCCCCTTCTCTCAGGGGC No data
Right 1191620408 X:63210045-63210067 TCACACAGCTTCCTGGGGACTGG No data
1191620395_1191620402 6 Left 1191620395 X:63209992-63210014 CCTGTCCCCCTTCTCTCAGGGGC No data
Right 1191620402 X:63210021-63210043 CTCCACAGGATAGATTGTCAGGG No data
1191620395_1191620403 7 Left 1191620395 X:63209992-63210014 CCTGTCCCCCTTCTCTCAGGGGC No data
Right 1191620403 X:63210022-63210044 TCCACAGGATAGATTGTCAGGGG No data
1191620395_1191620406 24 Left 1191620395 X:63209992-63210014 CCTGTCCCCCTTCTCTCAGGGGC No data
Right 1191620406 X:63210039-63210061 CAGGGGTCACACAGCTTCCTGGG No data
1191620395_1191620400 -8 Left 1191620395 X:63209992-63210014 CCTGTCCCCCTTCTCTCAGGGGC No data
Right 1191620400 X:63210007-63210029 TCAGGGGCTGCTCACTCCACAGG No data
1191620395_1191620407 25 Left 1191620395 X:63209992-63210014 CCTGTCCCCCTTCTCTCAGGGGC No data
Right 1191620407 X:63210040-63210062 AGGGGTCACACAGCTTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191620395 Original CRISPR GCCCCTGAGAGAAGGGGGAC AGG (reversed) Intergenic