ID: 1191620396

View in Genome Browser
Species Human (GRCh38)
Location X:63209997-63210019
Sequence GAGCAGCCCCTGAGAGAAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191620396_1191620406 19 Left 1191620396 X:63209997-63210019 CCCCCTTCTCTCAGGGGCTGCTC No data
Right 1191620406 X:63210039-63210061 CAGGGGTCACACAGCTTCCTGGG No data
1191620396_1191620401 0 Left 1191620396 X:63209997-63210019 CCCCCTTCTCTCAGGGGCTGCTC No data
Right 1191620401 X:63210020-63210042 ACTCCACAGGATAGATTGTCAGG No data
1191620396_1191620405 18 Left 1191620396 X:63209997-63210019 CCCCCTTCTCTCAGGGGCTGCTC No data
Right 1191620405 X:63210038-63210060 TCAGGGGTCACACAGCTTCCTGG No data
1191620396_1191620403 2 Left 1191620396 X:63209997-63210019 CCCCCTTCTCTCAGGGGCTGCTC No data
Right 1191620403 X:63210022-63210044 TCCACAGGATAGATTGTCAGGGG No data
1191620396_1191620408 25 Left 1191620396 X:63209997-63210019 CCCCCTTCTCTCAGGGGCTGCTC No data
Right 1191620408 X:63210045-63210067 TCACACAGCTTCCTGGGGACTGG No data
1191620396_1191620407 20 Left 1191620396 X:63209997-63210019 CCCCCTTCTCTCAGGGGCTGCTC No data
Right 1191620407 X:63210040-63210062 AGGGGTCACACAGCTTCCTGGGG No data
1191620396_1191620402 1 Left 1191620396 X:63209997-63210019 CCCCCTTCTCTCAGGGGCTGCTC No data
Right 1191620402 X:63210021-63210043 CTCCACAGGATAGATTGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191620396 Original CRISPR GAGCAGCCCCTGAGAGAAGG GGG (reversed) Intergenic