ID: 1191620398

View in Genome Browser
Species Human (GRCh38)
Location X:63209999-63210021
Sequence GTGAGCAGCCCCTGAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191620398_1191620402 -1 Left 1191620398 X:63209999-63210021 CCCTTCTCTCAGGGGCTGCTCAC No data
Right 1191620402 X:63210021-63210043 CTCCACAGGATAGATTGTCAGGG No data
1191620398_1191620403 0 Left 1191620398 X:63209999-63210021 CCCTTCTCTCAGGGGCTGCTCAC No data
Right 1191620403 X:63210022-63210044 TCCACAGGATAGATTGTCAGGGG No data
1191620398_1191620406 17 Left 1191620398 X:63209999-63210021 CCCTTCTCTCAGGGGCTGCTCAC No data
Right 1191620406 X:63210039-63210061 CAGGGGTCACACAGCTTCCTGGG No data
1191620398_1191620407 18 Left 1191620398 X:63209999-63210021 CCCTTCTCTCAGGGGCTGCTCAC No data
Right 1191620407 X:63210040-63210062 AGGGGTCACACAGCTTCCTGGGG No data
1191620398_1191620405 16 Left 1191620398 X:63209999-63210021 CCCTTCTCTCAGGGGCTGCTCAC No data
Right 1191620405 X:63210038-63210060 TCAGGGGTCACACAGCTTCCTGG No data
1191620398_1191620408 23 Left 1191620398 X:63209999-63210021 CCCTTCTCTCAGGGGCTGCTCAC No data
Right 1191620408 X:63210045-63210067 TCACACAGCTTCCTGGGGACTGG No data
1191620398_1191620401 -2 Left 1191620398 X:63209999-63210021 CCCTTCTCTCAGGGGCTGCTCAC No data
Right 1191620401 X:63210020-63210042 ACTCCACAGGATAGATTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191620398 Original CRISPR GTGAGCAGCCCCTGAGAGAA GGG (reversed) Intergenic