ID: 1191620400

View in Genome Browser
Species Human (GRCh38)
Location X:63210007-63210029
Sequence TCAGGGGCTGCTCACTCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191620393_1191620400 -7 Left 1191620393 X:63209991-63210013 CCCTGTCCCCCTTCTCTCAGGGG No data
Right 1191620400 X:63210007-63210029 TCAGGGGCTGCTCACTCCACAGG No data
1191620395_1191620400 -8 Left 1191620395 X:63209992-63210014 CCTGTCCCCCTTCTCTCAGGGGC No data
Right 1191620400 X:63210007-63210029 TCAGGGGCTGCTCACTCCACAGG No data
1191620387_1191620400 21 Left 1191620387 X:63209963-63209985 CCTTTGTCCCAAGGTGGGCTATG No data
Right 1191620400 X:63210007-63210029 TCAGGGGCTGCTCACTCCACAGG No data
1191620384_1191620400 29 Left 1191620384 X:63209955-63209977 CCATACTTCCTTTGTCCCAAGGT No data
Right 1191620400 X:63210007-63210029 TCAGGGGCTGCTCACTCCACAGG No data
1191620382_1191620400 30 Left 1191620382 X:63209954-63209976 CCCATACTTCCTTTGTCCCAAGG No data
Right 1191620400 X:63210007-63210029 TCAGGGGCTGCTCACTCCACAGG No data
1191620389_1191620400 14 Left 1191620389 X:63209970-63209992 CCCAAGGTGGGCTATGATGGACC No data
Right 1191620400 X:63210007-63210029 TCAGGGGCTGCTCACTCCACAGG No data
1191620390_1191620400 13 Left 1191620390 X:63209971-63209993 CCAAGGTGGGCTATGATGGACCC No data
Right 1191620400 X:63210007-63210029 TCAGGGGCTGCTCACTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191620400 Original CRISPR TCAGGGGCTGCTCACTCCAC AGG Intergenic