ID: 1191620401

View in Genome Browser
Species Human (GRCh38)
Location X:63210020-63210042
Sequence ACTCCACAGGATAGATTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191620390_1191620401 26 Left 1191620390 X:63209971-63209993 CCAAGGTGGGCTATGATGGACCC No data
Right 1191620401 X:63210020-63210042 ACTCCACAGGATAGATTGTCAGG No data
1191620393_1191620401 6 Left 1191620393 X:63209991-63210013 CCCTGTCCCCCTTCTCTCAGGGG No data
Right 1191620401 X:63210020-63210042 ACTCCACAGGATAGATTGTCAGG No data
1191620399_1191620401 -3 Left 1191620399 X:63210000-63210022 CCTTCTCTCAGGGGCTGCTCACT No data
Right 1191620401 X:63210020-63210042 ACTCCACAGGATAGATTGTCAGG No data
1191620396_1191620401 0 Left 1191620396 X:63209997-63210019 CCCCCTTCTCTCAGGGGCTGCTC No data
Right 1191620401 X:63210020-63210042 ACTCCACAGGATAGATTGTCAGG No data
1191620389_1191620401 27 Left 1191620389 X:63209970-63209992 CCCAAGGTGGGCTATGATGGACC No data
Right 1191620401 X:63210020-63210042 ACTCCACAGGATAGATTGTCAGG No data
1191620395_1191620401 5 Left 1191620395 X:63209992-63210014 CCTGTCCCCCTTCTCTCAGGGGC No data
Right 1191620401 X:63210020-63210042 ACTCCACAGGATAGATTGTCAGG No data
1191620398_1191620401 -2 Left 1191620398 X:63209999-63210021 CCCTTCTCTCAGGGGCTGCTCAC No data
Right 1191620401 X:63210020-63210042 ACTCCACAGGATAGATTGTCAGG No data
1191620397_1191620401 -1 Left 1191620397 X:63209998-63210020 CCCCTTCTCTCAGGGGCTGCTCA No data
Right 1191620401 X:63210020-63210042 ACTCCACAGGATAGATTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191620401 Original CRISPR ACTCCACAGGATAGATTGTC AGG Intergenic