ID: 1191620436

View in Genome Browser
Species Human (GRCh38)
Location X:63210188-63210210
Sequence TCATCTCGTTTAAGGCCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191620432_1191620436 -8 Left 1191620432 X:63210173-63210195 CCAATATGGTGCCCTTCATCTCG No data
Right 1191620436 X:63210188-63210210 TCATCTCGTTTAAGGCCTGAAGG No data
1191620429_1191620436 10 Left 1191620429 X:63210155-63210177 CCTACCATGGGTGCACAACCAAT No data
Right 1191620436 X:63210188-63210210 TCATCTCGTTTAAGGCCTGAAGG No data
1191620430_1191620436 6 Left 1191620430 X:63210159-63210181 CCATGGGTGCACAACCAATATGG No data
Right 1191620436 X:63210188-63210210 TCATCTCGTTTAAGGCCTGAAGG No data
1191620425_1191620436 27 Left 1191620425 X:63210138-63210160 CCCAGGAAGGGAAGTGGCCTACC No data
Right 1191620436 X:63210188-63210210 TCATCTCGTTTAAGGCCTGAAGG No data
1191620426_1191620436 26 Left 1191620426 X:63210139-63210161 CCAGGAAGGGAAGTGGCCTACCA No data
Right 1191620436 X:63210188-63210210 TCATCTCGTTTAAGGCCTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191620436 Original CRISPR TCATCTCGTTTAAGGCCTGA AGG Intergenic