ID: 1191621413

View in Genome Browser
Species Human (GRCh38)
Location X:63219392-63219414
Sequence CACATCTAGCACAAAGATCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191621413_1191621417 23 Left 1191621413 X:63219392-63219414 CCAAGATCTTTGTGCTAGATGTG No data
Right 1191621417 X:63219438-63219460 GCTTCTACTTACTCCTCTCAGGG No data
1191621413_1191621414 -7 Left 1191621413 X:63219392-63219414 CCAAGATCTTTGTGCTAGATGTG No data
Right 1191621414 X:63219408-63219430 AGATGTGCTTATTGCTGTTGAGG No data
1191621413_1191621416 22 Left 1191621413 X:63219392-63219414 CCAAGATCTTTGTGCTAGATGTG No data
Right 1191621416 X:63219437-63219459 TGCTTCTACTTACTCCTCTCAGG No data
1191621413_1191621419 25 Left 1191621413 X:63219392-63219414 CCAAGATCTTTGTGCTAGATGTG No data
Right 1191621419 X:63219440-63219462 TTCTACTTACTCCTCTCAGGGGG No data
1191621413_1191621418 24 Left 1191621413 X:63219392-63219414 CCAAGATCTTTGTGCTAGATGTG No data
Right 1191621418 X:63219439-63219461 CTTCTACTTACTCCTCTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191621413 Original CRISPR CACATCTAGCACAAAGATCT TGG (reversed) Intergenic
No off target data available for this crispr