ID: 1191621414

View in Genome Browser
Species Human (GRCh38)
Location X:63219408-63219430
Sequence AGATGTGCTTATTGCTGTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191621413_1191621414 -7 Left 1191621413 X:63219392-63219414 CCAAGATCTTTGTGCTAGATGTG No data
Right 1191621414 X:63219408-63219430 AGATGTGCTTATTGCTGTTGAGG No data
1191621411_1191621414 21 Left 1191621411 X:63219364-63219386 CCATTGAGTAGATAACAGTAAAT No data
Right 1191621414 X:63219408-63219430 AGATGTGCTTATTGCTGTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191621414 Original CRISPR AGATGTGCTTATTGCTGTTG AGG Intergenic
No off target data available for this crispr