ID: 1191621417

View in Genome Browser
Species Human (GRCh38)
Location X:63219438-63219460
Sequence GCTTCTACTTACTCCTCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191621413_1191621417 23 Left 1191621413 X:63219392-63219414 CCAAGATCTTTGTGCTAGATGTG No data
Right 1191621417 X:63219438-63219460 GCTTCTACTTACTCCTCTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191621417 Original CRISPR GCTTCTACTTACTCCTCTCA GGG Intergenic
No off target data available for this crispr