ID: 1191630040

View in Genome Browser
Species Human (GRCh38)
Location X:63312619-63312641
Sequence AGTTATCTGAAGAAGTTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191630036_1191630040 16 Left 1191630036 X:63312580-63312602 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 1191630040 X:63312619-63312641 AGTTATCTGAAGAAGTTGACAGG No data
1191630037_1191630040 15 Left 1191630037 X:63312581-63312603 CCAGTAACAGGCCAAGAGCTGTC 0: 162
1: 189
2: 129
3: 114
4: 178
Right 1191630040 X:63312619-63312641 AGTTATCTGAAGAAGTTGACAGG No data
1191630034_1191630040 25 Left 1191630034 X:63312571-63312593 CCACCAAAGCCCAGTAACAGGCC 0: 144
1: 161
2: 86
3: 68
4: 218
Right 1191630040 X:63312619-63312641 AGTTATCTGAAGAAGTTGACAGG No data
1191630035_1191630040 22 Left 1191630035 X:63312574-63312596 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 1191630040 X:63312619-63312641 AGTTATCTGAAGAAGTTGACAGG No data
1191630039_1191630040 4 Left 1191630039 X:63312592-63312614 CCAAGAGCTGTCTCTCAAAAGGA 0: 181
1: 197
2: 163
3: 130
4: 293
Right 1191630040 X:63312619-63312641 AGTTATCTGAAGAAGTTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191630040 Original CRISPR AGTTATCTGAAGAAGTTGAC AGG Intergenic
No off target data available for this crispr