ID: 1191631292

View in Genome Browser
Species Human (GRCh38)
Location X:63324848-63324870
Sequence ATTTATCTTCAGATAATGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191631292_1191631293 4 Left 1191631292 X:63324848-63324870 CCTGTCATTATCTGAAGATAAAT No data
Right 1191631293 X:63324875-63324897 TCATTTTGAGAGACAGCTTTTGG No data
1191631292_1191631294 16 Left 1191631292 X:63324848-63324870 CCTGTCATTATCTGAAGATAAAT No data
Right 1191631294 X:63324887-63324909 ACAGCTTTTGGCCTGTTACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191631292 Original CRISPR ATTTATCTTCAGATAATGAC AGG (reversed) Intergenic
No off target data available for this crispr