ID: 1191636051

View in Genome Browser
Species Human (GRCh38)
Location X:63378278-63378300
Sequence CAGGTTTACCAGCACACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191636051_1191636056 -10 Left 1191636051 X:63378278-63378300 CCAGTGGTGTGCTGGTAAACCTG No data
Right 1191636056 X:63378291-63378313 GGTAAACCTGCTCTTTAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191636051 Original CRISPR CAGGTTTACCAGCACACCAC TGG (reversed) Intergenic
No off target data available for this crispr