ID: 1191636056

View in Genome Browser
Species Human (GRCh38)
Location X:63378291-63378313
Sequence GGTAAACCTGCTCTTTAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191636048_1191636056 16 Left 1191636048 X:63378252-63378274 CCTCTTAAATACATTGTTGCTTA No data
Right 1191636056 X:63378291-63378313 GGTAAACCTGCTCTTTAGGGGGG No data
1191636051_1191636056 -10 Left 1191636051 X:63378278-63378300 CCAGTGGTGTGCTGGTAAACCTG No data
Right 1191636056 X:63378291-63378313 GGTAAACCTGCTCTTTAGGGGGG No data
1191636047_1191636056 25 Left 1191636047 X:63378243-63378265 CCAGAGAGACCTCTTAAATACAT No data
Right 1191636056 X:63378291-63378313 GGTAAACCTGCTCTTTAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191636056 Original CRISPR GGTAAACCTGCTCTTTAGGG GGG Intergenic
No off target data available for this crispr