ID: 1191638345

View in Genome Browser
Species Human (GRCh38)
Location X:63402417-63402439
Sequence ATGTAGTGGCTGAATGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191638345_1191638350 24 Left 1191638345 X:63402417-63402439 CCAAATTCATTCAGCCACTACAT No data
Right 1191638350 X:63402464-63402486 ACATTTCCAGATGTCTGCGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191638345 Original CRISPR ATGTAGTGGCTGAATGAATT TGG (reversed) Intergenic
No off target data available for this crispr