ID: 1191640502

View in Genome Browser
Species Human (GRCh38)
Location X:63426630-63426652
Sequence AACTGGTCCAGCCTGTAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191640502_1191640513 19 Left 1191640502 X:63426630-63426652 CCCGCTTACAGGCTGGACCAGTT No data
Right 1191640513 X:63426672-63426694 GTCTGGGATTGTTGTGAAAATGG No data
1191640502_1191640520 30 Left 1191640502 X:63426630-63426652 CCCGCTTACAGGCTGGACCAGTT No data
Right 1191640520 X:63426683-63426705 TTGTGAAAATGGGGTGGGGGCGG No data
1191640502_1191640517 25 Left 1191640502 X:63426630-63426652 CCCGCTTACAGGCTGGACCAGTT No data
Right 1191640517 X:63426678-63426700 GATTGTTGTGAAAATGGGGTGGG No data
1191640502_1191640515 21 Left 1191640502 X:63426630-63426652 CCCGCTTACAGGCTGGACCAGTT No data
Right 1191640515 X:63426674-63426696 CTGGGATTGTTGTGAAAATGGGG No data
1191640502_1191640508 -3 Left 1191640502 X:63426630-63426652 CCCGCTTACAGGCTGGACCAGTT No data
Right 1191640508 X:63426650-63426672 GTTACAGTCCCGGGCAGGAGAGG No data
1191640502_1191640519 27 Left 1191640502 X:63426630-63426652 CCCGCTTACAGGCTGGACCAGTT No data
Right 1191640519 X:63426680-63426702 TTGTTGTGAAAATGGGGTGGGGG No data
1191640502_1191640516 24 Left 1191640502 X:63426630-63426652 CCCGCTTACAGGCTGGACCAGTT No data
Right 1191640516 X:63426677-63426699 GGATTGTTGTGAAAATGGGGTGG No data
1191640502_1191640514 20 Left 1191640502 X:63426630-63426652 CCCGCTTACAGGCTGGACCAGTT No data
Right 1191640514 X:63426673-63426695 TCTGGGATTGTTGTGAAAATGGG No data
1191640502_1191640509 2 Left 1191640502 X:63426630-63426652 CCCGCTTACAGGCTGGACCAGTT No data
Right 1191640509 X:63426655-63426677 AGTCCCGGGCAGGAGAGGTCTGG No data
1191640502_1191640506 -8 Left 1191640502 X:63426630-63426652 CCCGCTTACAGGCTGGACCAGTT No data
Right 1191640506 X:63426645-63426667 GACCAGTTACAGTCCCGGGCAGG No data
1191640502_1191640510 3 Left 1191640502 X:63426630-63426652 CCCGCTTACAGGCTGGACCAGTT No data
Right 1191640510 X:63426656-63426678 GTCCCGGGCAGGAGAGGTCTGGG No data
1191640502_1191640518 26 Left 1191640502 X:63426630-63426652 CCCGCTTACAGGCTGGACCAGTT No data
Right 1191640518 X:63426679-63426701 ATTGTTGTGAAAATGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191640502 Original CRISPR AACTGGTCCAGCCTGTAAGC GGG (reversed) Intergenic
No off target data available for this crispr