ID: 1191640503

View in Genome Browser
Species Human (GRCh38)
Location X:63426631-63426653
Sequence TAACTGGTCCAGCCTGTAAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191640503_1191640508 -4 Left 1191640503 X:63426631-63426653 CCGCTTACAGGCTGGACCAGTTA No data
Right 1191640508 X:63426650-63426672 GTTACAGTCCCGGGCAGGAGAGG No data
1191640503_1191640520 29 Left 1191640503 X:63426631-63426653 CCGCTTACAGGCTGGACCAGTTA No data
Right 1191640520 X:63426683-63426705 TTGTGAAAATGGGGTGGGGGCGG No data
1191640503_1191640517 24 Left 1191640503 X:63426631-63426653 CCGCTTACAGGCTGGACCAGTTA No data
Right 1191640517 X:63426678-63426700 GATTGTTGTGAAAATGGGGTGGG No data
1191640503_1191640510 2 Left 1191640503 X:63426631-63426653 CCGCTTACAGGCTGGACCAGTTA No data
Right 1191640510 X:63426656-63426678 GTCCCGGGCAGGAGAGGTCTGGG No data
1191640503_1191640516 23 Left 1191640503 X:63426631-63426653 CCGCTTACAGGCTGGACCAGTTA No data
Right 1191640516 X:63426677-63426699 GGATTGTTGTGAAAATGGGGTGG No data
1191640503_1191640519 26 Left 1191640503 X:63426631-63426653 CCGCTTACAGGCTGGACCAGTTA No data
Right 1191640519 X:63426680-63426702 TTGTTGTGAAAATGGGGTGGGGG No data
1191640503_1191640514 19 Left 1191640503 X:63426631-63426653 CCGCTTACAGGCTGGACCAGTTA No data
Right 1191640514 X:63426673-63426695 TCTGGGATTGTTGTGAAAATGGG No data
1191640503_1191640506 -9 Left 1191640503 X:63426631-63426653 CCGCTTACAGGCTGGACCAGTTA No data
Right 1191640506 X:63426645-63426667 GACCAGTTACAGTCCCGGGCAGG No data
1191640503_1191640515 20 Left 1191640503 X:63426631-63426653 CCGCTTACAGGCTGGACCAGTTA No data
Right 1191640515 X:63426674-63426696 CTGGGATTGTTGTGAAAATGGGG No data
1191640503_1191640509 1 Left 1191640503 X:63426631-63426653 CCGCTTACAGGCTGGACCAGTTA No data
Right 1191640509 X:63426655-63426677 AGTCCCGGGCAGGAGAGGTCTGG No data
1191640503_1191640518 25 Left 1191640503 X:63426631-63426653 CCGCTTACAGGCTGGACCAGTTA No data
Right 1191640518 X:63426679-63426701 ATTGTTGTGAAAATGGGGTGGGG No data
1191640503_1191640513 18 Left 1191640503 X:63426631-63426653 CCGCTTACAGGCTGGACCAGTTA No data
Right 1191640513 X:63426672-63426694 GTCTGGGATTGTTGTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191640503 Original CRISPR TAACTGGTCCAGCCTGTAAG CGG (reversed) Intergenic
No off target data available for this crispr