ID: 1191640504

View in Genome Browser
Species Human (GRCh38)
Location X:63426640-63426662
Sequence GGCTGGACCAGTTACAGTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191640500_1191640504 -8 Left 1191640500 X:63426625-63426647 CCCTTCCCGCTTACAGGCTGGAC No data
Right 1191640504 X:63426640-63426662 GGCTGGACCAGTTACAGTCCCGG No data
1191640497_1191640504 -6 Left 1191640497 X:63426623-63426645 CCCCCTTCCCGCTTACAGGCTGG No data
Right 1191640504 X:63426640-63426662 GGCTGGACCAGTTACAGTCCCGG No data
1191640495_1191640504 0 Left 1191640495 X:63426617-63426639 CCAGAGCCCCCTTCCCGCTTACA No data
Right 1191640504 X:63426640-63426662 GGCTGGACCAGTTACAGTCCCGG No data
1191640501_1191640504 -9 Left 1191640501 X:63426626-63426648 CCTTCCCGCTTACAGGCTGGACC No data
Right 1191640504 X:63426640-63426662 GGCTGGACCAGTTACAGTCCCGG No data
1191640494_1191640504 10 Left 1191640494 X:63426607-63426629 CCAGCTAGTGCCAGAGCCCCCTT No data
Right 1191640504 X:63426640-63426662 GGCTGGACCAGTTACAGTCCCGG No data
1191640499_1191640504 -7 Left 1191640499 X:63426624-63426646 CCCCTTCCCGCTTACAGGCTGGA No data
Right 1191640504 X:63426640-63426662 GGCTGGACCAGTTACAGTCCCGG No data
1191640493_1191640504 27 Left 1191640493 X:63426590-63426612 CCTGCGGAGAGGGGGTACCAGCT No data
Right 1191640504 X:63426640-63426662 GGCTGGACCAGTTACAGTCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191640504 Original CRISPR GGCTGGACCAGTTACAGTCC CGG Intergenic
No off target data available for this crispr