ID: 1191640507

View in Genome Browser
Species Human (GRCh38)
Location X:63426647-63426669
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191640507_1191640521 22 Left 1191640507 X:63426647-63426669 CCAGTTACAGTCCCGGGCAGGAG No data
Right 1191640521 X:63426692-63426714 TGGGGTGGGGGCGGTGTGTTTGG No data
1191640507_1191640516 7 Left 1191640507 X:63426647-63426669 CCAGTTACAGTCCCGGGCAGGAG No data
Right 1191640516 X:63426677-63426699 GGATTGTTGTGAAAATGGGGTGG No data
1191640507_1191640514 3 Left 1191640507 X:63426647-63426669 CCAGTTACAGTCCCGGGCAGGAG No data
Right 1191640514 X:63426673-63426695 TCTGGGATTGTTGTGAAAATGGG No data
1191640507_1191640519 10 Left 1191640507 X:63426647-63426669 CCAGTTACAGTCCCGGGCAGGAG No data
Right 1191640519 X:63426680-63426702 TTGTTGTGAAAATGGGGTGGGGG No data
1191640507_1191640513 2 Left 1191640507 X:63426647-63426669 CCAGTTACAGTCCCGGGCAGGAG No data
Right 1191640513 X:63426672-63426694 GTCTGGGATTGTTGTGAAAATGG No data
1191640507_1191640515 4 Left 1191640507 X:63426647-63426669 CCAGTTACAGTCCCGGGCAGGAG No data
Right 1191640515 X:63426674-63426696 CTGGGATTGTTGTGAAAATGGGG No data
1191640507_1191640520 13 Left 1191640507 X:63426647-63426669 CCAGTTACAGTCCCGGGCAGGAG No data
Right 1191640520 X:63426683-63426705 TTGTGAAAATGGGGTGGGGGCGG No data
1191640507_1191640517 8 Left 1191640507 X:63426647-63426669 CCAGTTACAGTCCCGGGCAGGAG No data
Right 1191640517 X:63426678-63426700 GATTGTTGTGAAAATGGGGTGGG No data
1191640507_1191640518 9 Left 1191640507 X:63426647-63426669 CCAGTTACAGTCCCGGGCAGGAG No data
Right 1191640518 X:63426679-63426701 ATTGTTGTGAAAATGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191640507 Original CRISPR CTCCTGCCCGGGACTGTAAC TGG (reversed) Intergenic
No off target data available for this crispr