ID: 1191640508

View in Genome Browser
Species Human (GRCh38)
Location X:63426650-63426672
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191640495_1191640508 10 Left 1191640495 X:63426617-63426639 CCAGAGCCCCCTTCCCGCTTACA No data
Right 1191640508 X:63426650-63426672 GTTACAGTCCCGGGCAGGAGAGG No data
1191640500_1191640508 2 Left 1191640500 X:63426625-63426647 CCCTTCCCGCTTACAGGCTGGAC No data
Right 1191640508 X:63426650-63426672 GTTACAGTCCCGGGCAGGAGAGG No data
1191640502_1191640508 -3 Left 1191640502 X:63426630-63426652 CCCGCTTACAGGCTGGACCAGTT No data
Right 1191640508 X:63426650-63426672 GTTACAGTCCCGGGCAGGAGAGG No data
1191640501_1191640508 1 Left 1191640501 X:63426626-63426648 CCTTCCCGCTTACAGGCTGGACC No data
Right 1191640508 X:63426650-63426672 GTTACAGTCCCGGGCAGGAGAGG No data
1191640499_1191640508 3 Left 1191640499 X:63426624-63426646 CCCCTTCCCGCTTACAGGCTGGA No data
Right 1191640508 X:63426650-63426672 GTTACAGTCCCGGGCAGGAGAGG No data
1191640494_1191640508 20 Left 1191640494 X:63426607-63426629 CCAGCTAGTGCCAGAGCCCCCTT No data
Right 1191640508 X:63426650-63426672 GTTACAGTCCCGGGCAGGAGAGG No data
1191640497_1191640508 4 Left 1191640497 X:63426623-63426645 CCCCCTTCCCGCTTACAGGCTGG No data
Right 1191640508 X:63426650-63426672 GTTACAGTCCCGGGCAGGAGAGG No data
1191640503_1191640508 -4 Left 1191640503 X:63426631-63426653 CCGCTTACAGGCTGGACCAGTTA No data
Right 1191640508 X:63426650-63426672 GTTACAGTCCCGGGCAGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191640508 Original CRISPR GTTACAGTCCCGGGCAGGAG AGG Intergenic
No off target data available for this crispr