ID: 1191640520

View in Genome Browser
Species Human (GRCh38)
Location X:63426683-63426705
Sequence TTGTGAAAATGGGGTGGGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191640511_1191640520 2 Left 1191640511 X:63426658-63426680 CCCGGGCAGGAGAGGTCTGGGAT No data
Right 1191640520 X:63426683-63426705 TTGTGAAAATGGGGTGGGGGCGG No data
1191640503_1191640520 29 Left 1191640503 X:63426631-63426653 CCGCTTACAGGCTGGACCAGTTA No data
Right 1191640520 X:63426683-63426705 TTGTGAAAATGGGGTGGGGGCGG No data
1191640502_1191640520 30 Left 1191640502 X:63426630-63426652 CCCGCTTACAGGCTGGACCAGTT No data
Right 1191640520 X:63426683-63426705 TTGTGAAAATGGGGTGGGGGCGG No data
1191640512_1191640520 1 Left 1191640512 X:63426659-63426681 CCGGGCAGGAGAGGTCTGGGATT No data
Right 1191640520 X:63426683-63426705 TTGTGAAAATGGGGTGGGGGCGG No data
1191640507_1191640520 13 Left 1191640507 X:63426647-63426669 CCAGTTACAGTCCCGGGCAGGAG No data
Right 1191640520 X:63426683-63426705 TTGTGAAAATGGGGTGGGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191640520 Original CRISPR TTGTGAAAATGGGGTGGGGG CGG Intergenic
No off target data available for this crispr