ID: 1191640521

View in Genome Browser
Species Human (GRCh38)
Location X:63426692-63426714
Sequence TGGGGTGGGGGCGGTGTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191640511_1191640521 11 Left 1191640511 X:63426658-63426680 CCCGGGCAGGAGAGGTCTGGGAT No data
Right 1191640521 X:63426692-63426714 TGGGGTGGGGGCGGTGTGTTTGG No data
1191640512_1191640521 10 Left 1191640512 X:63426659-63426681 CCGGGCAGGAGAGGTCTGGGATT No data
Right 1191640521 X:63426692-63426714 TGGGGTGGGGGCGGTGTGTTTGG No data
1191640507_1191640521 22 Left 1191640507 X:63426647-63426669 CCAGTTACAGTCCCGGGCAGGAG No data
Right 1191640521 X:63426692-63426714 TGGGGTGGGGGCGGTGTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191640521 Original CRISPR TGGGGTGGGGGCGGTGTGTT TGG Intergenic
No off target data available for this crispr