ID: 1191640522

View in Genome Browser
Species Human (GRCh38)
Location X:63426708-63426730
Sequence TGTTTGGCTGCTGATAATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191640511_1191640522 27 Left 1191640511 X:63426658-63426680 CCCGGGCAGGAGAGGTCTGGGAT No data
Right 1191640522 X:63426708-63426730 TGTTTGGCTGCTGATAATGAAGG No data
1191640512_1191640522 26 Left 1191640512 X:63426659-63426681 CCGGGCAGGAGAGGTCTGGGATT No data
Right 1191640522 X:63426708-63426730 TGTTTGGCTGCTGATAATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191640522 Original CRISPR TGTTTGGCTGCTGATAATGA AGG Intergenic
No off target data available for this crispr