ID: 1191641174

View in Genome Browser
Species Human (GRCh38)
Location X:63430916-63430938
Sequence GGCTTCTGGAGTGTTGCCAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191641168_1191641174 19 Left 1191641168 X:63430874-63430896 CCAGCCTTGGATGATAGAGTCCA No data
Right 1191641174 X:63430916-63430938 GGCTTCTGGAGTGTTGCCACGGG No data
1191641169_1191641174 15 Left 1191641169 X:63430878-63430900 CCTTGGATGATAGAGTCCAGTTT No data
Right 1191641174 X:63430916-63430938 GGCTTCTGGAGTGTTGCCACGGG No data
1191641170_1191641174 -1 Left 1191641170 X:63430894-63430916 CCAGTTTTCAGAAGTATGCAATG No data
Right 1191641174 X:63430916-63430938 GGCTTCTGGAGTGTTGCCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191641174 Original CRISPR GGCTTCTGGAGTGTTGCCAC GGG Intergenic
No off target data available for this crispr