ID: 1191643658

View in Genome Browser
Species Human (GRCh38)
Location X:63454880-63454902
Sequence CGGGCTCTTACCACTTTTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191643658_1191643664 30 Left 1191643658 X:63454880-63454902 CCGAGAAAAGTGGTAAGAGCCCG No data
Right 1191643664 X:63454933-63454955 ACTATCATGAGAACAGCATGGGG 0: 1385
1: 3329
2: 5021
3: 5253
4: 4004
1191643658_1191643663 29 Left 1191643658 X:63454880-63454902 CCGAGAAAAGTGGTAAGAGCCCG No data
Right 1191643663 X:63454932-63454954 CACTATCATGAGAACAGCATGGG 0: 1974
1: 5205
2: 7851
3: 7948
4: 5813
1191643658_1191643662 28 Left 1191643658 X:63454880-63454902 CCGAGAAAAGTGGTAAGAGCCCG No data
Right 1191643662 X:63454931-63454953 TCACTATCATGAGAACAGCATGG 0: 2799
1: 5815
2: 7568
3: 6612
4: 4474

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191643658 Original CRISPR CGGGCTCTTACCACTTTTCT CGG (reversed) Intergenic
No off target data available for this crispr