ID: 1191643885

View in Genome Browser
Species Human (GRCh38)
Location X:63457795-63457817
Sequence ATGTCCATCTAGAATGATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191643883_1191643885 4 Left 1191643883 X:63457768-63457790 CCTGGCCTTGGAAAAAGGGACAT No data
Right 1191643885 X:63457795-63457817 ATGTCCATCTAGAATGATGAAGG No data
1191643879_1191643885 21 Left 1191643879 X:63457751-63457773 CCTCATTTACATTTACACCTGGC No data
Right 1191643885 X:63457795-63457817 ATGTCCATCTAGAATGATGAAGG No data
1191643884_1191643885 -1 Left 1191643884 X:63457773-63457795 CCTTGGAAAAAGGGACATAATAA No data
Right 1191643885 X:63457795-63457817 ATGTCCATCTAGAATGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191643885 Original CRISPR ATGTCCATCTAGAATGATGA AGG Intergenic
No off target data available for this crispr