ID: 1191653112

View in Genome Browser
Species Human (GRCh38)
Location X:63563584-63563606
Sequence ACTGATAACCAGATAGTCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191653108_1191653112 8 Left 1191653108 X:63563553-63563575 CCTATTATACCTAGATAGCTATC No data
Right 1191653112 X:63563584-63563606 ACTGATAACCAGATAGTCGAGGG No data
1191653109_1191653112 -1 Left 1191653109 X:63563562-63563584 CCTAGATAGCTATCCATGTGTGA No data
Right 1191653112 X:63563584-63563606 ACTGATAACCAGATAGTCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191653112 Original CRISPR ACTGATAACCAGATAGTCGA GGG Intergenic
No off target data available for this crispr