ID: 1191658804

View in Genome Browser
Species Human (GRCh38)
Location X:63629799-63629821
Sequence GACAGCTCTTGGCTTGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191658804_1191658808 15 Left 1191658804 X:63629799-63629821 CCAGTAACAAGCCAAGAGCTGTC No data
Right 1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG No data
1191658804_1191658809 16 Left 1191658804 X:63629799-63629821 CCAGTAACAAGCCAAGAGCTGTC No data
Right 1191658809 X:63629838-63629860 GTTATCTGCTGAAGATGGCAGGG No data
1191658804_1191658807 11 Left 1191658804 X:63629799-63629821 CCAGTAACAAGCCAAGAGCTGTC No data
Right 1191658807 X:63629833-63629855 GAGTAGTTATCTGCTGAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191658804 Original CRISPR GACAGCTCTTGGCTTGTTAC TGG (reversed) Intergenic
No off target data available for this crispr