ID: 1191658808

View in Genome Browser
Species Human (GRCh38)
Location X:63629837-63629859
Sequence AGTTATCTGCTGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191658802_1191658808 22 Left 1191658802 X:63629792-63629814 CCACAGCCCAGTAACAAGCCAAG No data
Right 1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG No data
1191658804_1191658808 15 Left 1191658804 X:63629799-63629821 CCAGTAACAAGCCAAGAGCTGTC No data
Right 1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG No data
1191658806_1191658808 4 Left 1191658806 X:63629810-63629832 CCAAGAGCTGTCTTTAAAAAGGA No data
Right 1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG No data
1191658803_1191658808 16 Left 1191658803 X:63629798-63629820 CCCAGTAACAAGCCAAGAGCTGT No data
Right 1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191658808 Original CRISPR AGTTATCTGCTGAAGATGGC AGG Intergenic
No off target data available for this crispr