ID: 1191660184

View in Genome Browser
Species Human (GRCh38)
Location X:63641498-63641520
Sequence TCCCCACCCTATGTATCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191660184_1191660191 26 Left 1191660184 X:63641498-63641520 CCTGGAGATACATAGGGTGGGGA 0: 1
1: 0
2: 0
3: 34
4: 132
Right 1191660191 X:63641547-63641569 GAGTTAGCAGGGCTATCTTCTGG 0: 1
1: 0
2: 0
3: 8
4: 70
1191660184_1191660190 15 Left 1191660184 X:63641498-63641520 CCTGGAGATACATAGGGTGGGGA 0: 1
1: 0
2: 0
3: 34
4: 132
Right 1191660190 X:63641536-63641558 ATGCTTGGCATGAGTTAGCAGGG 0: 1
1: 0
2: 0
3: 14
4: 112
1191660184_1191660189 14 Left 1191660184 X:63641498-63641520 CCTGGAGATACATAGGGTGGGGA 0: 1
1: 0
2: 0
3: 34
4: 132
Right 1191660189 X:63641535-63641557 AATGCTTGGCATGAGTTAGCAGG 0: 1
1: 0
2: 1
3: 7
4: 126
1191660184_1191660186 0 Left 1191660184 X:63641498-63641520 CCTGGAGATACATAGGGTGGGGA 0: 1
1: 0
2: 0
3: 34
4: 132
Right 1191660186 X:63641521-63641543 AGGACCTTGACCAAAATGCTTGG 0: 1
1: 0
2: 1
3: 11
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191660184 Original CRISPR TCCCCACCCTATGTATCTCC AGG (reversed) Intronic
901125898 1:6928530-6928552 TCCCCACCCTAACTCTCCCCTGG + Intronic
907819545 1:57953767-57953789 GCCCCTCCCTATTTATCTGCTGG + Intronic
909809043 1:79907604-79907626 ACCCCACCCAATATATCTCCTGG - Intergenic
914697158 1:150095206-150095228 TCATCACCCTATTTATTTCCTGG - Intronic
914923411 1:151862926-151862948 CCCCCACCCTATCCATCTCTGGG - Intergenic
915091423 1:153428957-153428979 ACCCCACTCCATGTGTCTCCTGG + Intergenic
915606020 1:156951421-156951443 TCCCCACCCCCAGTATCTTCAGG - Intronic
917098387 1:171422541-171422563 TCCCCACCAAATGGATCTGCTGG + Intergenic
917265427 1:173216188-173216210 TCCCCACCCTAGGCATCAGCAGG + Intergenic
919981299 1:202644121-202644143 TCCCCACCCTCAGTCTGTCCTGG + Intronic
923402974 1:233633130-233633152 TCTCCACCCCATGTTTCTCCAGG - Intronic
1064924222 10:20552140-20552162 CCCACACCCTATTTCTCTCCAGG - Intergenic
1067991884 10:51223185-51223207 CCCCCACCCTCTGTAGCTCCTGG + Intronic
1075969525 10:126640614-126640636 ACCCCACCCCAGGTCTCTCCAGG - Intronic
1077216826 11:1398478-1398500 TCTCCACCCCCTGTATCCCCAGG - Intronic
1078462489 11:11525141-11525163 TCCCCACCCTGTCTATATTCCGG - Intronic
1084163900 11:67366261-67366283 TCCCGACCCTTTTTCTCTCCTGG - Intronic
1085052806 11:73388490-73388512 TCCCCACCCCATCTAGGTCCTGG - Intronic
1085521337 11:77140603-77140625 GCCCCACCCTAGGGAGCTCCAGG + Intronic
1087667715 11:101070205-101070227 TCCCCACTCTTTGTACTTCCCGG - Intronic
1090732367 11:129582900-129582922 TCGCCATCCTAGGTATCTCGTGG + Intergenic
1091954692 12:4628693-4628715 TCCCCACCAAATGATTCTCCGGG + Exonic
1092566835 12:9674359-9674381 TCCCCACCCTGTGCAGCTCCTGG + Intronic
1097974494 12:65670023-65670045 TCCCTACCCCATCTGTCTCCTGG - Intergenic
1099588809 12:84558574-84558596 TCCTCTCCTTCTGTATCTCCAGG + Intergenic
1101560487 12:105853121-105853143 TCCCCACCCCTGGTATCCCCAGG - Intergenic
1103983329 12:124750879-124750901 TCCCCATCCCAGGTCTCTCCAGG - Intergenic
1105256138 13:18745022-18745044 TCCCTTCCCTATGTGTCTCCTGG - Intergenic
1106003546 13:25747628-25747650 TCCCCACGCATTGTATCCCCAGG - Intronic
1107467453 13:40664449-40664471 CCCCCACGCTAAGTCTCTCCTGG + Intronic
1107709054 13:43134549-43134571 CCCCCACCAAATGTATCTGCTGG - Intergenic
1111918150 13:94383183-94383205 TCCCCACCCTATGAAAATCCAGG - Intronic
1113681075 13:112245537-112245559 TCCCCACCTTCTGCTTCTCCAGG - Intergenic
1115043859 14:28965309-28965331 TCTCAACCCTATATAACTCCTGG - Intergenic
1115221240 14:31060713-31060735 TCCCCAGCCTCTGTATTTGCTGG + Intronic
1117856806 14:60042678-60042700 TCCCCACCCTTTGCACTTCCCGG + Intronic
1118903700 14:70007661-70007683 TCCCCAGCCTTTCTCTCTCCTGG + Intronic
1119662093 14:76459409-76459431 CCTCCACCCTCTGTTTCTCCAGG - Intronic
1123922627 15:25081170-25081192 CCCCCACACCATGTATGTCCAGG - Intergenic
1125927912 15:43578312-43578334 TGCTCACCCTATGTTTCTCCTGG - Intronic
1125941055 15:43677877-43677899 TGCTCACCCTATGTTTCTCCTGG - Intergenic
1130193345 15:81756894-81756916 TCCCCACCTTATCTAGCCCCCGG - Intergenic
1130702275 15:86196553-86196575 TACCCACCCCATGTGTATCCAGG - Intronic
1134001141 16:10783918-10783940 TCCCCACCCTCTGGAACTCCTGG - Intronic
1138477932 16:57283244-57283266 TCCCCAACCTCTGAATCTCCTGG - Intronic
1140258174 16:73354798-73354820 TCATCACCCTGAGTATCTCCCGG + Intergenic
1141406855 16:83802191-83802213 GCACCACCCCATTTATCTCCAGG + Intergenic
1142399727 16:89852563-89852585 TCCCCACCCCCTGGATCCCCTGG + Intronic
1143479053 17:7218309-7218331 TCCCCACCCCAGGCCTCTCCAGG + Intronic
1144677106 17:17168636-17168658 GCCCCACCCTTTGTAGCTGCAGG + Intronic
1144759578 17:17699824-17699846 ACCCCACCCTGTGCCTCTCCTGG + Intronic
1145260278 17:21350642-21350664 TCCACACCATCAGTATCTCCGGG + Intergenic
1145316341 17:21737298-21737320 TCCACACCATCAGTATCTCCGGG - Intergenic
1151481784 17:74373870-74373892 TCCCCACCCTCAGCCTCTCCAGG + Intergenic
1152705349 17:81840816-81840838 TCCCAACCCTCTGTCTCTCCAGG - Intergenic
1153650635 18:7236936-7236958 CCACCACCCTATGTATGCCCGGG + Intergenic
1154434897 18:14335656-14335678 TCCCTTCCCTATGTGTCTCCTGG + Intergenic
1159420574 18:68213747-68213769 TCCCCACCCTGTGTTTCTAATGG - Intergenic
1159505283 18:69328085-69328107 CCCCCACCCCAGGTAACTCCTGG + Intergenic
1159799647 18:72882047-72882069 TCCCTACCCTAAGTCTCTCTTGG - Intergenic
1160549613 18:79685178-79685200 CCCCCACACTAGGAATCTCCAGG - Intronic
1160556883 18:79731143-79731165 GCCCCACCCCATGTGTCCCCAGG - Intronic
1160841923 19:1150170-1150192 TCCCCACCCCATGGTTCTCTGGG + Intronic
1161990430 19:7681350-7681372 TCCCCACCCCATTTCTCTTCAGG + Intronic
1162572751 19:11482357-11482379 TCCCCACCCCGTGTTCCTCCCGG + Intronic
1162802637 19:13119441-13119463 CCCCCACCTTATATATCTACAGG + Intronic
1163635169 19:18434094-18434116 TCCCCACCCCATGTCTGCCCAGG + Intronic
1165247296 19:34504943-34504965 TCCCCACCCCAAGGTTCTCCTGG - Exonic
1165898737 19:39158544-39158566 TCCCCACCCTGAGTACCTCTGGG + Intronic
1202636761 1_KI270706v1_random:50357-50379 TCACTTCCCTATGTGTCTCCTGG - Intergenic
927485327 2:23484924-23484946 TCCCATCCCTACCTATCTCCTGG + Intronic
928790917 2:34952009-34952031 TCCCCACCCTATCTATGCTCTGG + Intergenic
929898692 2:45983385-45983407 TCCCCAGCCCATGGATGTCCTGG + Intronic
934491138 2:94762651-94762673 TCCCTTCCCTATGTGTCTCCTGG - Intergenic
938330032 2:130442678-130442700 TCCCTTCCCCATGTGTCTCCTGG - Intergenic
938359913 2:130678825-130678847 TCCCTTCCCCATGTGTCTCCTGG + Intergenic
940787017 2:157992289-157992311 TCCACACCCCACCTATCTCCGGG - Intronic
944898423 2:204189306-204189328 GCCTCACCCTGTGTATCTCCAGG - Intergenic
945920600 2:215751200-215751222 TCCCCACTTTATGTAGCTCTTGG + Intergenic
946269310 2:218577332-218577354 TCCCCACCCTAGATATTTCCTGG + Intronic
946879206 2:224160580-224160602 TCACCACCCTATTTTTTTCCTGG - Intergenic
1171880877 20:30616773-30616795 TCCCTTCCCTATGTGTCTCCTGG - Intergenic
1173182516 20:40815667-40815689 TCACCATCCTATATATCTGCAGG + Intergenic
1173863455 20:46298943-46298965 CCCCCACCCCACTTATCTCCTGG + Intronic
1174737762 20:52981916-52981938 TCCCCATCCTATTCACCTCCAGG - Intronic
1175403849 20:58714911-58714933 TCCCCACCCTGAGGAGCTCCCGG + Intronic
1175989013 20:62778338-62778360 TCCCCAGCCTATCTATCTGATGG + Intergenic
1176842139 21:13850046-13850068 TCCCTTCCCTATGTGTCTCCTGG - Intergenic
1179078859 21:38151369-38151391 TCCCCACTTTATGTATCTCTTGG - Intronic
1180364110 22:11923956-11923978 TCACTTCCCTATGTGTCTCCTGG + Intergenic
1181620679 22:24089184-24089206 TTCTCACCCTATTTATTTCCTGG - Intronic
1182394390 22:30024937-30024959 TCCCCGACCCATGCATCTCCAGG - Intronic
1182855525 22:33514389-33514411 TGCCAGCCCTCTGTATCTCCAGG + Intronic
1184770732 22:46595131-46595153 CCCCCACCCTGTGTGTCTCCAGG - Intronic
1185182797 22:49372861-49372883 TCCCCACCCTCTCTGTCCCCAGG + Intergenic
949823460 3:8139756-8139778 TCCCCACCAAATGGATCTGCTGG - Intergenic
951345532 3:21543380-21543402 TCCCCACCCCTTGTCGCTCCTGG + Intronic
952178234 3:30890544-30890566 TCGCCTCCCTATGAATCACCTGG + Intronic
956327808 3:68072407-68072429 ACACCACCCTCTGTAACTCCTGG - Intronic
958699262 3:97567648-97567670 TCTCTACCCTGTGTTTCTCCTGG - Intronic
963524859 3:146404931-146404953 TCCCCACCCTGAGTATGTCCAGG - Intronic
965729719 3:171758433-171758455 TCCCCACCATCTGTCTCTCTGGG + Intronic
967641466 3:191869911-191869933 TCCCCACCCTGTGTCCATCCAGG + Intergenic
968344560 3:197990637-197990659 TCGTCACACTGTGTATCTCCTGG + Exonic
968350108 3:198046603-198046625 TCCCTTCCCTGTGTGTCTCCTGG - Intergenic
968512268 4:1000975-1000997 TCGCCCACCGATGTATCTCCTGG - Exonic
969154517 4:5198644-5198666 TCACCACCCCATGGATCACCAGG - Intronic
969440130 4:7212051-7212073 TCCCCATCCTCTGTATCAACAGG - Intronic
971944779 4:33260188-33260210 TCCACACCTGATGTATTTCCAGG + Intergenic
973366570 4:49213691-49213713 TCCCTTCCCTATGTGTCTCCTGG - Intergenic
973394043 4:49578708-49578730 TCACTTCCCTATGTGTCTCCTGG + Intergenic
974681754 4:65173731-65173753 TTCCCATCCTTTGTATCTCCAGG + Intergenic
981324665 4:143432097-143432119 TCCCCACCATGTCTCTCTCCCGG - Intronic
985354489 4:189103213-189103235 TCCCCACCAAATGGATCTACTGG + Intergenic
1202764076 4_GL000008v2_random:136228-136250 TCACTTCCCTATGTGTCTCCTGG - Intergenic
988790072 5:34599617-34599639 TCCCCACCCTGTCTGTCTCTGGG - Intergenic
994323583 5:98422732-98422754 TCCCCACCCTTTTTAGCACCAGG + Intergenic
994819770 5:104634473-104634495 TCCCCAACCTTTTTGTCTCCAGG + Intergenic
997991165 5:138545306-138545328 TCCCCACCCTATGAAAATACAGG - Intergenic
1004187175 6:13430814-13430836 TCCTCACCCTCTCTTTCTCCAGG + Intronic
1005927012 6:30452659-30452681 GCCCCACCCTTTGCCTCTCCTGG - Intergenic
1006784730 6:36658575-36658597 ACCCCAAGCTATGTAACTCCAGG - Intergenic
1007301360 6:40870304-40870326 TCCCCACCAAATGGATCTGCTGG - Intergenic
1008413262 6:51208055-51208077 TCCCAACTCAATGTATCTCTCGG + Intergenic
1011482800 6:87811953-87811975 TCCCCACCCAATGGATCCACTGG + Intergenic
1014985848 6:128008072-128008094 TCTCCAACATATATATCTCCAGG + Intronic
1015713368 6:136165629-136165651 TCCTCACCCAAGGTATCTGCTGG + Intronic
1016142981 6:140636384-140636406 TCCACACCATTTGTATCTCTGGG - Intergenic
1017678921 6:156843925-156843947 TCCCCACCCCATGCAGCTTCAGG - Intronic
1018470709 6:164095495-164095517 TCACCCACCTATTTATCTCCTGG - Intergenic
1019399742 7:845755-845777 CCCCCACCCAATCCATCTCCTGG + Intronic
1024614012 7:51092266-51092288 TCCCCACCCTTTGTGGCACCAGG - Intronic
1027231481 7:76275218-76275240 ACCCCACCCCATGTTTATCCCGG + Intronic
1031218956 7:118938616-118938638 TCCCTACACTATGTATCTGAGGG + Intergenic
1034385648 7:150738389-150738411 GCCCCAGCCCATGTATTTCCAGG - Intronic
1034430086 7:151036779-151036801 TCCCCACCCTATGCATCCCTGGG - Intronic
1035191959 7:157177707-157177729 TCCTCACCCCCTGTCTCTCCTGG + Intronic
1036919801 8:12841297-12841319 TGACCACCCTATTTATCTCTGGG - Intergenic
1037589314 8:20300051-20300073 CCCCCACCCACTCTATCTCCAGG - Intronic
1039235032 8:35492980-35493002 TCCCCACCCTAGGAATTTCATGG - Intronic
1039509728 8:38081363-38081385 CCCCCACCCAATGGATCTGCTGG + Intergenic
1042273178 8:66976434-66976456 TCCCCAACCTTTGTAGCACCAGG - Intronic
1042842483 8:73138002-73138024 TCACCACCCTGTGTGTCTCAGGG + Intergenic
1042850560 8:73212036-73212058 TCCCCACCCTATTTATTTGCAGG - Intergenic
1048603739 8:135946196-135946218 TCCCCACCCTTGCCATCTCCAGG - Intergenic
1052880623 9:33599217-33599239 TCCCTTCCCTATGTGTCTCCTGG + Intergenic
1053495350 9:38544994-38545016 TCCCTTCCCTATGTGTCTCCTGG - Intronic
1053666835 9:40323029-40323051 TCCCTTCCCTATGTGTCTCCTGG + Intronic
1053916430 9:42948136-42948158 TCCCTTCCCTATGTGTCTCCTGG + Intergenic
1054377987 9:64463057-64463079 TCCCTTCCCTTTGTGTCTCCTGG + Intergenic
1054517774 9:66053254-66053276 TCCCTTCCCTATGTGTCTCCTGG - Intergenic
1055985878 9:82056318-82056340 TCCCTTCCCTATGTGTCTCCTGG + Intergenic
1056406608 9:86281953-86281975 TCCCCACCCCACGCACCTCCAGG + Intronic
1056585461 9:87924812-87924834 TCCCTTCCCTATGTGTCTCCTGG - Intergenic
1056611419 9:88128131-88128153 TCCCTTCCCTATGTGTCTCCTGG + Intergenic
1057675247 9:97132351-97132373 TCCCTTCCCTATGTGTCTCCTGG - Intergenic
1057744082 9:97737712-97737734 TCCCCACCCTCTGTTCCTGCCGG - Intergenic
1057935339 9:99233753-99233775 CCTCCACCCCATATATCTCCTGG - Intergenic
1061969067 9:134034175-134034197 TCCCCCCCATATGTGTGTCCTGG + Intronic
1203544825 Un_KI270743v1:121101-121123 TCACTTCCCTATGTGTCTCCTGG - Intergenic
1189301975 X:39958648-39958670 TGCCCACCCTAGGGCTCTCCAGG + Intergenic
1189479888 X:41384394-41384416 TCCCCACCCTAGGGCTCTCTGGG + Intergenic
1191660184 X:63641498-63641520 TCCCCACCCTATGTATCTCCAGG - Intronic
1197516375 X:127435149-127435171 TCCTTACCCCATGTATCTCCTGG + Intergenic
1200872726 Y:8121084-8121106 TCCCTACCCTGTGTTCCTCCTGG - Intergenic
1201352901 Y:13065718-13065740 TCCCCACTCTATGTTTTTCTTGG - Intergenic
1202101251 Y:21310175-21310197 TCCCTACCCTGTGTTCCTCCTGG - Intergenic