ID: 1191662918

View in Genome Browser
Species Human (GRCh38)
Location X:63669122-63669144
Sequence GAGAGCGTCAAATGAGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 94}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191662917_1191662918 -4 Left 1191662917 X:63669103-63669125 CCACTTCACATGGCTGTTTGAGA 0: 1
1: 0
2: 3
3: 29
4: 358
Right 1191662918 X:63669122-63669144 GAGAGCGTCAAATGAGTTCATGG 0: 1
1: 0
2: 0
3: 4
4: 94
1191662914_1191662918 6 Left 1191662914 X:63669093-63669115 CCTGTTTGACCCACTTCACATGG 0: 1
1: 0
2: 1
3: 7
4: 137
Right 1191662918 X:63669122-63669144 GAGAGCGTCAAATGAGTTCATGG 0: 1
1: 0
2: 0
3: 4
4: 94
1191662916_1191662918 -3 Left 1191662916 X:63669102-63669124 CCCACTTCACATGGCTGTTTGAG 0: 1
1: 1
2: 2
3: 40
4: 315
Right 1191662918 X:63669122-63669144 GAGAGCGTCAAATGAGTTCATGG 0: 1
1: 0
2: 0
3: 4
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191662918 Original CRISPR GAGAGCGTCAAATGAGTTCA TGG Intronic
904669730 1:32154711-32154733 GAGAGCAACAAGTGAGTTAATGG + Exonic
905056349 1:35097126-35097148 GAGAGGGTCACTTGAGTACAGGG + Intronic
905549317 1:38823465-38823487 GTGAGAGTCAAATGAATTCATGG + Intergenic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
906899754 1:49821398-49821420 CATAGGGTCAAATGAGATCAAGG + Intronic
909042018 1:70665863-70665885 GAGGGAGACAAATGAGTTGATGG + Intergenic
911015665 1:93329626-93329648 GAGAGCCTTAAATGTGTCCATGG - Intergenic
913123002 1:115759006-115759028 GAGAAGGTAAAATGAGTGCATGG + Intronic
914451609 1:147797811-147797833 GAGTGGATCAAATGAGATCAGGG + Intergenic
920682045 1:208080761-208080783 GTGAGGATCAAATGAGCTCATGG - Intronic
920797438 1:209153972-209153994 GAGAGTTAAAAATGAGTTCATGG + Intergenic
1063910124 10:10821014-10821036 GATAGATTCAAATGATTTCAAGG + Intergenic
1066410002 10:35158453-35158475 CAGAGGGTAAAAAGAGTTCAAGG + Intronic
1069126965 10:64647549-64647571 GAGACAGTCAAGTGAGGTCATGG + Intergenic
1072958902 10:99912036-99912058 GTGAGTATTAAATGAGTTCAGGG - Intronic
1076299116 10:129411405-129411427 GAGAGCGGGAGCTGAGTTCAAGG - Intergenic
1078506980 11:11959459-11959481 GAGGGTTTCAAAGGAGTTCATGG + Intergenic
1079117974 11:17652701-17652723 AAGAGGGTCAAGTGAGATCATGG + Intergenic
1080304136 11:30818547-30818569 ATGAGGGTCAAATGAGCTCATGG - Intergenic
1080774937 11:35377114-35377136 GTGAGCGCTAAATGAGTTAATGG - Intronic
1086616086 11:88821831-88821853 AACAGGGACAAATGAGTTCATGG - Intronic
1092069211 12:5619135-5619157 GAGAGCCTCTAATGTGTCCAAGG + Intronic
1096439833 12:51631661-51631683 GAGATCATCAAAAGACTTCAGGG - Intronic
1100793098 12:98152197-98152219 GAGAGAGTGAAATGGTTTCAAGG - Intergenic
1101800121 12:108014440-108014462 GCTAGAGTCACATGAGTTCAAGG + Intergenic
1104792744 12:131494009-131494031 GAAATCCTCAAATGAGCTCAAGG - Intergenic
1106925924 13:34613144-34613166 GAGATGGCCAAATGAGTCCAAGG - Intergenic
1121690066 14:95871816-95871838 GACAGAGTCAAGTGAGCTCAGGG + Intergenic
1121968568 14:98334871-98334893 GATAGCCTCACATGAATTCAGGG + Intergenic
1129140127 15:73590312-73590334 GAGAGCTTCAAATAAGCTGAGGG + Intronic
1133307169 16:4817706-4817728 GAGAGAGACTGATGAGTTCAGGG + Intronic
1134337097 16:13310402-13310424 AAGACCTTCAAATGAATTCATGG - Intergenic
1134463169 16:14447814-14447836 GAAAGCCTCAAATAAATTCAAGG + Intronic
1134738601 16:16522308-16522330 GGGAGGGTTAAATGACTTCATGG - Intergenic
1137764297 16:50966120-50966142 GAGAGCTGCAATTCAGTTCATGG - Intergenic
1146202074 17:30867306-30867328 GGGAGGGTCACATGAGTCCAAGG + Intronic
1146699205 17:34939665-34939687 GAGATCTTCAAAAGAATTCACGG + Exonic
1162743827 19:12788476-12788498 CAGAGAGACAAATGGGTTCAAGG - Intronic
1167881971 19:52466968-52466990 GAAAACGTGAAATGAGTTCAAGG - Intronic
1168482474 19:56733308-56733330 GAAGGCCACAAATGAGTTCATGG + Intergenic
926039852 2:9664312-9664334 GGGAGCATTAAATAAGTTCAAGG - Intergenic
926351241 2:11996756-11996778 GTGTGCATCAAATGAGTTAATGG + Intergenic
929880318 2:45831029-45831051 GAGAGCGTCAGCTCAGATCAGGG + Intronic
930834774 2:55781659-55781681 AAGAGGGTAAAATGAGTCCAGGG - Intergenic
933464249 2:82631342-82631364 GAGAACGTGAATTGAGTACAAGG + Intergenic
938773250 2:134519263-134519285 GGGAACGTCAACAGAGTTCATGG - Intronic
940524108 2:154790462-154790484 GGAAGCCTCAGATGAGTTCAAGG - Intronic
943230285 2:185242218-185242240 GAGACGTTCAGATGAGTTCAGGG + Intergenic
948067152 2:235089245-235089267 CAGAACGGCAAATGAGCTCAGGG + Intergenic
1169022196 20:2338819-2338841 GAAGGGGTCAAATGAGATCAAGG - Intronic
1172193345 20:33075492-33075514 GAGACGGTCAAAGGAGGTCAAGG - Intergenic
1172750618 20:37248430-37248452 GAGAGAGTCCCCTGAGTTCAGGG - Intergenic
1174331527 20:49823241-49823263 GTGAGGATCAAATGAGATCAGGG - Intronic
1178121926 21:29477918-29477940 GAGAGCGTGAAATGAGGCCGGGG + Intronic
1182057681 22:27372719-27372741 GTGAACTTCAAATGATTTCAGGG + Intergenic
1182200798 22:28567295-28567317 GAGAGGATCAATTGAGCTCAGGG + Intronic
1183657485 22:39196337-39196359 GAGAGAGTAAAATGATTTAAAGG - Intergenic
1184263603 22:43333870-43333892 GAGAGGATTAAATGAGATCATGG + Intronic
951339231 3:21464077-21464099 GAGAGATTTAAATGAGTTTAAGG - Intronic
951836247 3:26986576-26986598 GAGAGAGTCAAATGATTGCAGGG - Intergenic
966328128 3:178780181-178780203 GATTGCTTCAAAGGAGTTCAGGG - Intronic
967314031 3:188133901-188133923 GAGAACTTCAAATGTGTACATGG - Intergenic
972453537 4:39229586-39229608 TAGAACGTCAAAGGAATTCACGG - Intronic
972570473 4:40306115-40306137 GAAAGAGGCAAATGAGATCACGG + Intergenic
974463384 4:62220299-62220321 GAGAGAGGACAATGAGTTCAAGG - Intergenic
977175619 4:93816302-93816324 GACCACGTCAAATGAGTTGAAGG + Intergenic
977728656 4:100325926-100325948 GAAAGCCTCAAATGAGTTGAAGG + Intergenic
980208821 4:129758276-129758298 GAGAGGGACAAAGGAGTTGATGG - Intergenic
992121626 5:73599559-73599581 GAGATCGGCAAATAAGTTCCAGG - Intergenic
992258156 5:74942788-74942810 GAGAGCTTCAAATGCTTACAAGG + Intergenic
993930279 5:93930623-93930645 AAGAGCACCAGATGAGTTCAAGG + Intronic
999531948 5:152473332-152473354 GAGAGCTTCAAATGTGCTGAAGG + Intergenic
1001222958 5:169918684-169918706 GAGAGGATCACCTGAGTTCAGGG + Intronic
1007173486 6:39880562-39880584 GAGAGCCTGAGATGAGTTAAGGG + Intronic
1008333410 6:50270636-50270658 GAGAGAGCCAAATCAGGTCAGGG - Intergenic
1009288862 6:61859171-61859193 AAGAGCTTCAAATGATTACAAGG + Intronic
1018518747 6:164618690-164618712 GAGGGAGTTACATGAGTTCAAGG - Intergenic
1019791776 7:3018819-3018841 GAGAGCTTCAACTGAATCCAAGG + Intronic
1023723823 7:43121434-43121456 CAGAGGGTCAAAAGAGTGCATGG - Intronic
1025971819 7:66333901-66333923 GATAGTGACAAATGAGTTTAGGG - Intronic
1027639931 7:80720323-80720345 GAAAGCATAAAATGAGATCATGG + Intergenic
1028545848 7:91998733-91998755 GAGAAAGTAAAATCAGTTCATGG - Intronic
1030233747 7:107235912-107235934 GATAGCCTGAAATGATTTCAAGG + Intronic
1031398783 7:121305990-121306012 GGGAGGATCACATGAGTTCAGGG - Intergenic
1032898705 7:136281727-136281749 GGGAGGATCAACTGAGTTCAGGG + Intergenic
1036615416 8:10383877-10383899 GAGAGCGTCAAAGGATATTAGGG + Intronic
1041926725 8:63244406-63244428 GAGAACATGAAATGAGCTCAGGG - Intergenic
1047945279 8:129870424-129870446 GAGAGAGTTAAATGATTCCATGG - Intronic
1050829863 9:9997639-9997661 GAGAGAGTAAAAAGAGTTCTTGG + Intronic
1055418269 9:76108067-76108089 AATAGCCTCAAATGAGTTTATGG - Intronic
1055813222 9:80176637-80176659 GAGAGGGTCACTTGAGTCCAAGG - Intergenic
1058392629 9:104513213-104513235 GAGAGGGAAACATGAGTTCAAGG - Intergenic
1060772272 9:126341034-126341056 AAGAGAGCTAAATGAGTTCATGG - Intronic
1190327194 X:49213864-49213886 AAGAGCGTCAAACGTGTTCCAGG + Exonic
1190538752 X:51456189-51456211 GAGAGGGTTAAAGGAGTTCTCGG + Intergenic
1191662918 X:63669122-63669144 GAGAGCGTCAAATGAGTTCATGG + Intronic
1192837249 X:74813843-74813865 GTGAGGGTCAAATGAGATAAGGG + Intronic
1193589746 X:83374503-83374525 GAGAGAATCAAATGAGGTGAAGG + Intergenic
1195613309 X:106893441-106893463 AAGAGATTCAAATGAGATCACGG + Intronic