ID: 1191665942

View in Genome Browser
Species Human (GRCh38)
Location X:63702765-63702787
Sequence CAGAAAATGCAGAAGTAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2483
Summary {0: 1, 1: 4, 2: 2, 3: 129, 4: 2347}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191665937_1191665942 24 Left 1191665937 X:63702718-63702740 CCATGCTTGAGTAAGACATGCTT 0: 1
1: 0
2: 0
3: 15
4: 140
Right 1191665942 X:63702765-63702787 CAGAAAATGCAGAAGTAGCCTGG 0: 1
1: 4
2: 2
3: 129
4: 2347
1191665940_1191665942 1 Left 1191665940 X:63702741-63702763 CCAATGGTACCAAGAAGGAAGAA 0: 1
1: 0
2: 0
3: 24
4: 237
Right 1191665942 X:63702765-63702787 CAGAAAATGCAGAAGTAGCCTGG 0: 1
1: 4
2: 2
3: 129
4: 2347
1191665941_1191665942 -8 Left 1191665941 X:63702750-63702772 CCAAGAAGGAAGAAGCAGAAAAT 0: 1
1: 0
2: 7
3: 84
4: 669
Right 1191665942 X:63702765-63702787 CAGAAAATGCAGAAGTAGCCTGG 0: 1
1: 4
2: 2
3: 129
4: 2347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191665942 Original CRISPR CAGAAAATGCAGAAGTAGCC TGG Intronic
Too many off-targets to display for this crispr