ID: 1191667044

View in Genome Browser
Species Human (GRCh38)
Location X:63714234-63714256
Sequence CTGAAGAAGGAGTAGGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 585
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 543}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191667044_1191667055 22 Left 1191667044 X:63714234-63714256 CCTGCCCCCTACTCCTTCTTCAG 0: 1
1: 0
2: 3
3: 38
4: 543
Right 1191667055 X:63714279-63714301 TATCATTCTTCTTTTGTCCCTGG 0: 1
1: 0
2: 4
3: 36
4: 322

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191667044 Original CRISPR CTGAAGAAGGAGTAGGGGGC AGG (reversed) Intronic
900141591 1:1141278-1141300 GTGAAGAAGGGGTAGGGGATGGG - Intergenic
900959104 1:5908098-5908120 CTGAGGAATGAATGGGGGGCGGG + Intronic
901040315 1:6359469-6359491 CTGAAGCAGGGGTTGGGGGAAGG - Intronic
901228367 1:7628163-7628185 ATGGAGAAGGAGAAGGGAGCTGG - Intronic
901343583 1:8518054-8518076 CTGAAGAAAGGGGAAGGGGCAGG + Intronic
902192851 1:14775729-14775751 TTGAAGCAGGAGAAAGGGGCAGG + Intronic
902207693 1:14881419-14881441 CACAAGAAGGACTAGAGGGCAGG + Intronic
902448567 1:16483237-16483259 CTGAAGAATAAGTCGGCGGCTGG - Intergenic
903790439 1:25889436-25889458 CTGGAGAAGGAGTAGGTGTGGGG - Intronic
903926102 1:26831809-26831831 CTGAAGAATGAGTAGAGGGCTGG - Intronic
904031257 1:27534814-27534836 CTGCAGGGGGTGTAGGGGGCAGG + Exonic
904115718 1:28160467-28160489 CTGAGGAAGGAGGATGGGTCAGG + Intronic
904273629 1:29366477-29366499 CTGAAGAATGAGGAGGGGTCAGG + Intergenic
904610121 1:31721196-31721218 CTGAGGAAGGAGGAGGGAGCTGG + Intergenic
905108671 1:35578666-35578688 CTGGAGAAGGAGGAGGGAGCTGG + Intronic
905172649 1:36118332-36118354 GTAGAGCAGGAGTAGGGGGCAGG - Intronic
907412010 1:54289790-54289812 CTGGAGATGGTGCAGGGGGCGGG - Intronic
907481804 1:54750109-54750131 TTGAAGAAGGAATTGGGGGGTGG + Intergenic
907822813 1:57987767-57987789 CTGGTGAAGGAGTTGGGGGAGGG + Intronic
909113262 1:71505575-71505597 CTAAAGAGGGTGTAGGGGGCCGG - Intronic
910203670 1:84725823-84725845 CCAAAGAAGGAGTAGGGTGAAGG - Intergenic
911553427 1:99312734-99312756 CAGAAGTAGGAGTAGGAGGGAGG + Intergenic
911882546 1:103259628-103259650 ATGAATAAGTAGGAGGGGGCAGG + Intergenic
912228633 1:107766232-107766254 AAGAAGAAGGAGGAGGGGGAAGG - Intronic
912258616 1:108086220-108086242 CTGAAGAAGGGGTAGGGATAAGG + Intergenic
912498919 1:110108954-110108976 CTGCAGAGGGAGCAGGGGGATGG - Intergenic
912601984 1:110945382-110945404 CGGAAGAAGGAAGAGGGGGAGGG - Intergenic
912623763 1:111191200-111191222 CTAAGGAAGGATGAGGGGGCCGG + Intronic
913532747 1:119744205-119744227 GTGCAGAAGGAGTTGGGGGTAGG - Exonic
915045349 1:153008854-153008876 CAGGAGAAAGAGTAGAGGGCTGG - Intergenic
915075972 1:153308288-153308310 ATGAAGAAAGAGAAGGAGGCTGG - Intronic
915169563 1:153968398-153968420 GTGAGGAAGGAGTGGGGGGGCGG + Intronic
915186048 1:154105962-154105984 GTCAAGAACGAGAAGGGGGCTGG + Intronic
915301286 1:154953048-154953070 CTGAGGAGGGAGAAGGGGGTTGG - Intronic
915333819 1:155129279-155129301 CTGGAGGAGGAGGAGGGGACAGG + Intronic
915598845 1:156909982-156910004 TTGGAGAAGGAGTGGGGAGCAGG - Intronic
915826704 1:159085677-159085699 ATCATGAAGGAGAAGGGGGCAGG + Intronic
915930872 1:160060185-160060207 CTTAAGAAGGAGGATGGGGTAGG + Intronic
916717273 1:167456009-167456031 CTGAGGAAGGGGGAGGGGGCGGG - Intronic
921468745 1:215523044-215523066 CTGGAGATGGGGTTGGGGGCAGG - Intergenic
922681705 1:227603631-227603653 ATGAAGCAGCAGAAGGGGGCTGG - Intronic
923176756 1:231474345-231474367 CTGAAGCAGGAGCCGGGGGTGGG + Intergenic
923246577 1:232138152-232138174 TTGAAGCAGGAGTTGGGGGAAGG - Intergenic
923329267 1:232907481-232907503 AAGAAGAAGAAGTAAGGGGCTGG + Intergenic
923785087 1:237058787-237058809 CTGGAGAAGGGGCGGGGGGCCGG + Intronic
1063322262 10:5061270-5061292 CTGAAGAAGGAGCTGGTGACAGG + Intronic
1064212217 10:13369645-13369667 TTGAAAAAGGAGTAGAAGGCCGG + Intergenic
1065787889 10:29233167-29233189 CCGATGAAGAATTAGGGGGCTGG + Intergenic
1065865631 10:29912831-29912853 CTGGAGCAGGAGGAAGGGGCTGG - Intergenic
1067346537 10:45442411-45442433 TTGAAGAAGGACTTGGGTGCTGG - Intronic
1068499039 10:57819829-57819851 CTGAAGAAGGAGGAGTGGTGGGG + Intergenic
1070520791 10:77251394-77251416 CTGAAGCAGTAATGGGGGGCTGG - Intronic
1070746863 10:78939022-78939044 CTGGAGTAGGAGTAGGGTCCGGG + Intergenic
1072151820 10:92690140-92690162 GTGAAGGAGGAGTTGGGGGACGG - Exonic
1072497162 10:95973131-95973153 GTGAGCAAGGAGGAGGGGGCGGG + Intronic
1072578351 10:96720137-96720159 CTGAAGAAGTGGGAGGGGGTCGG + Intronic
1072957135 10:99897249-99897271 ATGAAGAAGGAGTGGGTGGGTGG + Intronic
1073014550 10:100387430-100387452 TTAAAGAAGGATTAGAGGGCCGG - Intergenic
1073015616 10:100396799-100396821 CTGAATCAGGAGTAATGGGCAGG + Intergenic
1073479922 10:103779937-103779959 CTGAAGAAGGGGGAAGGGGAAGG + Intronic
1073502467 10:103953005-103953027 CTGAAGACGGAGGAGGGAGGCGG + Intergenic
1074008764 10:109456087-109456109 GGGAAGAAGGAATAAGGGGCGGG + Intergenic
1074183994 10:111085711-111085733 CAGAAGAAAGAGTAAGGGGGCGG + Intergenic
1075292390 10:121241592-121241614 CTGAAGAAGGAGCAGCAGGCAGG + Intergenic
1075515451 10:123104556-123104578 CTGGAGATGGAGTTGGGGCCTGG + Intergenic
1075645222 10:124092476-124092498 AGGAGGAAGGAGGAGGGGGCGGG + Intronic
1075899910 10:126033156-126033178 CTGAATGAGGAGTAGGGAACTGG - Intronic
1076838411 10:133032723-133032745 ATGAGGAGGGAGAAGGGGGCAGG - Intergenic
1077354399 11:2108589-2108611 GTGGGGAAGGAGGAGGGGGCTGG - Intergenic
1077730588 11:4725080-4725102 CTGAAGAAGGAGCAAGGGGGAGG - Intronic
1079019776 11:16899978-16900000 CTGGATAAGGTGTGGGGGGCAGG + Intronic
1079360665 11:19767858-19767880 CTGAAGGAAGCCTAGGGGGCTGG - Intronic
1079411292 11:20190226-20190248 CTGAAGAAAGAGTAGGAGTGAGG - Intergenic
1079551328 11:21702327-21702349 CTGAAGATGGGGGAAGGGGCAGG - Intergenic
1080081733 11:28227760-28227782 GTGAAGAATGAGTAGGAGGAGGG + Intronic
1080387257 11:31817521-31817543 CTGAGCTGGGAGTAGGGGGCGGG - Intronic
1081652339 11:44832758-44832780 CTGAACAAGGAGAAGGCTGCAGG - Intronic
1081814239 11:45929643-45929665 CTGGGGAAGGGGTAGGGGGGTGG + Intronic
1081828195 11:46079649-46079671 CTCAAGAAGGAGTTCGGTGCAGG + Intronic
1083655694 11:64228366-64228388 TTGAAAAAGGAGTAAGTGGCCGG + Intronic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084773237 11:71357680-71357702 CTGAACAAGGAGTCCTGGGCTGG + Intergenic
1084926879 11:72520917-72520939 GTTAAGAAGGAGTAGAGGCCGGG - Intergenic
1085033025 11:73284054-73284076 TTGAAGGAGGAGTTGAGGGCTGG + Intronic
1086045283 11:82524970-82524992 CTGAAGGAGGTGGAGGGGGGTGG - Intergenic
1086084482 11:82940697-82940719 CAGGAGCAAGAGTAGGGGGCAGG + Intronic
1086924891 11:92629705-92629727 CTGAAGAAGGGGAAGGAGGTTGG - Intronic
1087952276 11:104237463-104237485 CAGGAGATGGAGTTGGGGGCAGG + Intergenic
1089572451 11:119419521-119419543 CTGCAGAAAGAGAAGGGGGCCGG + Intronic
1089667980 11:120032411-120032433 CTGCTGAAGGGGTAGGTGGCAGG - Intergenic
1090198680 11:124839092-124839114 AGGGAGAAGGAATAGGGGGCAGG - Intergenic
1090256938 11:125291120-125291142 CTGCAGAAAGAATAGGGGACAGG + Intronic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1091718196 12:2794747-2794769 CAGGAGAAGGGGGAGGGGGCAGG + Intergenic
1091721575 12:2817825-2817847 GTGAAGCAGGAGGAGCGGGCAGG - Intronic
1091838490 12:3602619-3602641 CTGAAGAAAGAGTAGAAGGATGG - Intergenic
1091843256 12:3635307-3635329 CTGGAGAAGGAGTACCTGGCTGG + Intronic
1092143541 12:6200129-6200151 TTGAAGAAGGAGTGGGTGGCGGG + Intronic
1092578055 12:9811756-9811778 CTGAAGAAGTGAGAGGGGGCTGG + Intergenic
1092981393 12:13798158-13798180 CTGAGGAAGGAGAATGGGTCAGG - Intronic
1095111970 12:38305574-38305596 CTGATGAAGGAGTAGGTTCCTGG - Intergenic
1095201916 12:39394816-39394838 CTAAAGAAGGGATGGGGGGCGGG + Intronic
1096193044 12:49632570-49632592 CCGAAGAAAGAGGAGGGGGAAGG - Intronic
1096528419 12:52228133-52228155 AAGAAGAAGGAGGAGGGGGAGGG - Intergenic
1097221712 12:57455107-57455129 CTGAAGTAGGGGTATGGGGGTGG - Intronic
1097527733 12:60759382-60759404 TTGAAGATGGAGAAGGGGGCAGG - Intergenic
1097983158 12:65754956-65754978 CTCAGGAGGGAGAAGGGGGCGGG + Intergenic
1098005604 12:65993791-65993813 CTGAAGAAAGATGAGGGAGCTGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098495882 12:71135285-71135307 AAGAAGAAGGAGGAGGGGGAGGG + Intronic
1100342074 12:93688857-93688879 CTGAAGAAGAATTAGGGTGATGG - Intronic
1101213250 12:102555744-102555766 TTGAAGAAGGAGTAGGGACTAGG - Intergenic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1101847257 12:108372448-108372470 TTTAATAAGTAGTAGGGGGCTGG + Intergenic
1101969699 12:109304528-109304550 CTGATGAAGGGGCAGGGGACTGG - Intronic
1102426497 12:112848111-112848133 TTGAAGAAGGGGCAGGGGGAGGG + Intronic
1103032945 12:117632520-117632542 TAGAAAAAGGAGTAGGTGGCAGG - Intronic
1103613553 12:122138401-122138423 CTGCAGAAGGGGCAGGTGGCTGG - Intronic
1104065843 12:125305158-125305180 CTGAAGAAGTTGTAGGAGACGGG - Intronic
1104695176 12:130858049-130858071 CTGAAGATGGAGGATGGGTCAGG - Intergenic
1105538832 13:21297195-21297217 CTGAAGATGGAGGCGGGGACTGG - Intergenic
1105544124 13:21339456-21339478 CTGAAGAATGAGGATGGGGCGGG - Intergenic
1105799420 13:23890369-23890391 CTGAAGATGGAGGCGGGGACTGG + Intergenic
1105849628 13:24322669-24322691 CTGAAGATGGAGGCGGGGACTGG - Intergenic
1107451335 13:40512778-40512800 CTGAAGAAGGGAAAGGGTGCAGG - Intergenic
1111379436 13:87427529-87427551 CGGAAGATGGAGTAGAGAGCTGG + Intergenic
1111760442 13:92457405-92457427 CTGGGGAAGGAGAAGGGTGCTGG - Intronic
1113849170 13:113408113-113408135 CTGAGGATGGAGTGGGCGGCCGG + Intergenic
1113883884 13:113647243-113647265 CTGAAGAAAGAGTGGGGCTCTGG + Intergenic
1114182353 14:20377526-20377548 CTTGGGAAGGGGTAGGGGGCAGG + Intronic
1114458577 14:22872610-22872632 CGGAAGAGGGAGTGGGGGGCGGG - Intronic
1114803414 14:25805523-25805545 ATGAAGTAGCAGTAGGGAGCAGG - Intergenic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1118762125 14:68886342-68886364 AAGAAGAAAGAGTAGGGGGAAGG - Intronic
1119574961 14:75711770-75711792 CTGAAGAAGGAACTGGGGGTGGG - Intronic
1119670816 14:76516885-76516907 CTGAAGAAGGACCAAGTGGCTGG - Intergenic
1121144606 14:91573600-91573622 ATGAAAAGGGAGGAGGGGGCTGG + Intergenic
1121491616 14:94365148-94365170 CAGAAGGAGGAGACGGGGGCTGG + Intergenic
1121510459 14:94509410-94509432 CCGAAAAAGGACTAGGAGGCTGG - Intronic
1122047769 14:99035834-99035856 TTGCAGAAGGAGAAGGGGCCGGG + Intergenic
1122207718 14:100156537-100156559 CAGATGAAGGAGTTGGGGCCTGG - Intronic
1122454870 14:101842346-101842368 CTGAAACAGGAGGAGAGGGCAGG + Intronic
1122863076 14:104591297-104591319 CTGAAGGAGGGGCAGGAGGCAGG - Intronic
1123091792 14:105745254-105745276 GTGCAGGAGGAGCAGGGGGCAGG - Intergenic
1124983655 15:34584741-34584763 CTGAAGACGGGGGGGGGGGCGGG + Intronic
1125665710 15:41428562-41428584 AAAAAAAAGGAGTAGGGGGCCGG - Intronic
1126675286 15:51155465-51155487 CTGGGGAAGGAATTGGGGGCCGG + Intergenic
1126691063 15:51289405-51289427 CTGGAGCAGGAGTCAGGGGCAGG - Intronic
1126928740 15:53622622-53622644 CTGAGGAGGGAGCAGGGGGAGGG + Intronic
1127451279 15:59118781-59118803 CTGAAAAAGGAGGAGATGGCAGG - Intronic
1128510116 15:68308443-68308465 TTTAAGAAGGACTAGAGGGCTGG + Intronic
1129053174 15:72799184-72799206 CTGGAGAATGAGAAGGGGACAGG - Intergenic
1129758364 15:78112163-78112185 CTGAATAATGGGCAGGGGGCGGG - Intronic
1129816692 15:78561669-78561691 CTGAAGGAGGAGTAGGAGTTAGG + Intergenic
1129826562 15:78638485-78638507 CTGAAGAAGGCTCAGGGGTCAGG - Intronic
1130678217 15:85973300-85973322 CTGAGGAGGGAGTAGGGGTTAGG - Intergenic
1131067746 15:89444717-89444739 CTTCAGATGGAGTGGGGGGCAGG - Intergenic
1132709167 16:1258864-1258886 CTCAGGATGGAGGAGGGGGCAGG - Exonic
1133924577 16:10182568-10182590 CTGAAGAGGGAGGAAGCGGCAGG - Intronic
1134066709 16:11233108-11233130 ATGAAGAGGGAGGAGGGGGTTGG - Intergenic
1134287181 16:12872035-12872057 AAGAAGAAGGAGGAGGGGGGAGG - Intergenic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG + Intronic
1135671852 16:24382261-24382283 GTGGAGAAGGAGGAGGGGGAGGG - Intergenic
1136110531 16:28061848-28061870 CTGAAGAAGGAGGTGGGGCGGGG + Intronic
1136120025 16:28126898-28126920 CTGAAGTAGGGGGAGGGAGCAGG - Intronic
1136233449 16:28901053-28901075 CTGAAGGAGGATTTGTGGGCTGG + Intronic
1136612281 16:31373400-31373422 CTGGGGAAGGAGGAGGAGGCAGG + Intronic
1137014560 16:35362218-35362240 CTGAAGACGGAGCAGAGGCCAGG - Intergenic
1137374560 16:47941604-47941626 AAGAGGAAGGAGTAGGGGGAGGG + Intergenic
1137525992 16:49236762-49236784 ATGAAGATGGAGGAGGGGGGTGG + Intergenic
1137532445 16:49287949-49287971 CTGAAGATGGAGAAGGAGGAAGG - Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137622658 16:49886507-49886529 TTGGAGAAGGAGTAGGGCTCGGG - Intergenic
1137783374 16:51116312-51116334 GGGAAAAAGGAGAAGGGGGCTGG - Intergenic
1137904835 16:52310507-52310529 CTGAACCAGGAGCAGGAGGCTGG + Intergenic
1137942990 16:52707263-52707285 CTGAAGGAGGAGCAGGAGGTAGG - Intergenic
1138475830 16:57270265-57270287 CTGGAGATGGACTCGGGGGCTGG - Intronic
1138475836 16:57270284-57270306 CTGGGGAAGGACTCGGGGGCTGG - Intronic
1138574992 16:57901830-57901852 CTGAAGAATGAGTAGGAGTTTGG - Intronic
1138962061 16:62038827-62038849 TTGGAGAAGGAGTTGGGGGGAGG + Intergenic
1139237283 16:65353064-65353086 CTGCAGAGGAAGTAGGGGGTGGG + Intergenic
1139351071 16:66336153-66336175 GAGAAGAAGGAGTAGGAAGCAGG - Intergenic
1139478658 16:67216142-67216164 CTGAAGAAGGAGCAGTGGAAAGG - Intronic
1139529868 16:67537773-67537795 CTCAGGAAAGAGGAGGGGGCGGG + Intronic
1139808347 16:69589288-69589310 CTAAAAAAGAAGTAGGAGGCTGG - Intronic
1139910393 16:70394089-70394111 GTGAACAGGGAATAGGGGGCAGG - Intronic
1139970811 16:70773552-70773574 CTGAGGAGGGAAGAGGGGGCTGG + Intronic
1141149827 16:81556266-81556288 CTGCAGAAGGAGGTGGCGGCGGG + Intronic
1141168427 16:81676062-81676084 AGGAGGATGGAGTAGGGGGCAGG + Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141636384 16:85316167-85316189 CTGAAAATGGAATAGGTGGCTGG - Intergenic
1141845116 16:86603371-86603393 AGGAAGAAGGAGGAGGGGGAAGG - Intergenic
1141946115 16:87311097-87311119 CTGAAGAGTGAGGTGGGGGCCGG - Intronic
1142014871 16:87740099-87740121 CTGGAGAAGGTGCAGGGGGTTGG - Intronic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1142529640 17:571211-571233 CTGAAGTAGGAGGAGGGGAAGGG + Intronic
1142541056 17:659797-659819 CTGAACAAGGAGTAGAGAGAAGG - Intronic
1143167745 17:4906201-4906223 CTGAAGAAGGATCATGGGGTTGG + Intergenic
1143385160 17:6524898-6524920 TTGAAGAAGGAGTATATGGCTGG - Intronic
1143588335 17:7863730-7863752 CAGGAGTAGGAGTAGGGGGTTGG - Intronic
1144070196 17:11664591-11664613 CTGAGGAAGGAGGATGGGGTTGG - Intronic
1145240319 17:21237126-21237148 TTGAAGAAGGAGATGTGGGCTGG - Intergenic
1145736962 17:27239906-27239928 CTGAAGGAAGGGCAGGGGGCGGG - Intergenic
1145741293 17:27276871-27276893 CTGGAGAAGGACTTGGGGGAAGG - Intergenic
1145982759 17:29023761-29023783 CTGATGTGGGAGTAGGGGGCAGG - Intronic
1146354864 17:32125464-32125486 CTGGAGAAGCAGCAGGGGCCTGG - Intergenic
1147196582 17:38770560-38770582 GGGAAGAAGGAAGAGGGGGCAGG + Intronic
1147794707 17:43034159-43034181 CTGAGGAAGGTGTGGGGGGAGGG + Intergenic
1147912317 17:43862970-43862992 CTGGAGAAGGGGTCGGGGGTGGG + Exonic
1148082418 17:44974869-44974891 ATGGGGATGGAGTAGGGGGCAGG + Intergenic
1148097711 17:45064938-45064960 CTGAAGAAAGAGGAGGAGGGAGG - Intronic
1148150008 17:45391378-45391400 CTGAGGAGGGTGTAGGGGGCAGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148792820 17:50183292-50183314 CTTAAAAAGGAGTAGGCGGGAGG + Exonic
1149596666 17:57868342-57868364 CCGGAGAGGGAGCAGGGGGCAGG + Intronic
1150875782 17:68968794-68968816 CTAAAGAAGGAGATGGGGCCAGG - Intergenic
1151947184 17:77326089-77326111 TGGAAGAAGGGGTAGGAGGCGGG - Intronic
1152012219 17:77725612-77725634 CTGAAGTAGGAGAAGGAGGTTGG + Intergenic
1152183418 17:78839932-78839954 CTTTAGAAGGAGGAGGGAGCGGG - Intronic
1152323776 17:79623941-79623963 TTGAAGAAGGAAGAGGGAGCTGG + Intergenic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1153268449 18:3295368-3295390 CCCAGGAAGGAGCAGGGGGCTGG + Intergenic
1155071771 18:22323146-22323168 CTGCAGGAGGAGGAGAGGGCTGG + Intergenic
1155377555 18:25176968-25176990 AGGCAGAAGGAGAAGGGGGCTGG - Intronic
1157083815 18:44556353-44556375 AATAAGGAGGAGTAGGGGGCTGG + Intergenic
1157191471 18:45585769-45585791 ATGCAGAGGGAGAAGGGGGCAGG - Intronic
1158140028 18:54245723-54245745 CTGGAGAAGGGGTTGGAGGCAGG - Intergenic
1159540305 18:69766247-69766269 CTGAAGAAGGAGGAGGGCAAGGG + Intronic
1159581184 18:70236155-70236177 ATGAAGGAGAACTAGGGGGCTGG + Intergenic
1159743002 18:72196504-72196526 CTGAATAAGGAAAAGGGGGAGGG + Intergenic
1160391900 18:78540350-78540372 CTGAAGATGGAGGTGGAGGCTGG + Intergenic
1160543735 18:79639265-79639287 CTGGTGAGGGAGTGGGGGGCTGG + Intergenic
1161085616 19:2333607-2333629 CTCAAAATGAAGTAGGGGGCAGG - Intronic
1161219576 19:3112299-3112321 CTGAAGTCGGAGTCCGGGGCAGG + Intronic
1161437164 19:4270529-4270551 CTGAAAAAGGGGGAGGGGGGTGG + Intergenic
1161810322 19:6467692-6467714 CTGAGGAAGGATCAAGGGGCTGG + Exonic
1162496281 19:11024990-11025012 ATGAGGAAGGAGGTGGGGGCGGG - Intronic
1162560954 19:11418192-11418214 CGGGAGAGGGAGTAGGGGACAGG - Intronic
1163768033 19:19174191-19174213 CTGTGGACGGAGCAGGGGGCAGG + Intronic
1163784941 19:19270159-19270181 CTGCAGAAGGTGCAGGAGGCAGG - Exonic
1164686869 19:30172448-30172470 CTGGAGCAGGAGAAGGGAGCTGG + Intergenic
1164809806 19:31147138-31147160 GGGAAGAAGCTGTAGGGGGCTGG + Intergenic
1165445725 19:35856094-35856116 CTGAAGGAGGGCTGGGGGGCTGG - Intronic
1165821184 19:38677102-38677124 CTGAAGAATGAGGAGGAGGTAGG - Intronic
1166211459 19:41309235-41309257 CTGAAGAACGAGTAGGAGCTGGG - Intronic
1166549776 19:43657539-43657561 CTGAAGAATGAGTAGGAGTTAGG - Intronic
1166875181 19:45892595-45892617 CTGAGGAAGGAGCAGGGTGGGGG - Intronic
1167083738 19:47294928-47294950 CTGAAGGATGAGGAGTGGGCCGG - Intronic
1167741396 19:51326734-51326756 GGGAAGGAGGAGGAGGGGGCGGG - Intronic
1167887761 19:52516147-52516169 CTGAAGGAGGAGAAAGGGACAGG - Intergenic
1167937661 19:52921090-52921112 CTGAAGGAGGAGAAAGGGACAGG + Intergenic
1168663476 19:58184819-58184841 ATGAATAAGAAATAGGGGGCCGG + Intronic
925023303 2:588318-588340 CAGCAGAAGGTGGAGGGGGCGGG + Intergenic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
925224120 2:2167711-2167733 CTGGAGAAGGCGTGGAGGGCTGG - Intronic
925282657 2:2695616-2695638 CTCAAGAAGGAATAAGAGGCAGG + Intergenic
927560825 2:24071725-24071747 CTGAAGAATGAGGAGGAGCCAGG + Intronic
927882221 2:26696866-26696888 AAGTAGAAGGAGTAGGGGACTGG - Intronic
928518203 2:32063656-32063678 CCGAGGAAGGAGAAAGGGGCGGG + Exonic
929033912 2:37672647-37672669 CTGGGGAAGGAGTAGGCGACAGG + Intronic
929271866 2:39981471-39981493 GAGAAGAAGGGGTAGGAGGCTGG + Intergenic
929490921 2:42395404-42395426 TTTAAGAAGGAGTTGGGGCCAGG + Intronic
929536599 2:42787997-42788019 CTGAAGGAGGAGTTGGGGCAGGG - Intronic
929576964 2:43058006-43058028 CTCAGGAAGCAGGAGGGGGCTGG - Intergenic
930017167 2:46978897-46978919 CTGAAGAAGGGGTAGGTCACTGG + Exonic
930967511 2:57348190-57348212 TTGTAAAAGGTGTAGGGGGCAGG + Intergenic
931952599 2:67381997-67382019 CTGAAGAAGGGGAAGGGGAGGGG + Intergenic
932112625 2:69014318-69014340 ATAAGGAAGGAGTGGGGGGCGGG - Intronic
932427012 2:71644341-71644363 CTTGGGAAGGGGTAGGGGGCTGG - Intronic
932790779 2:74653167-74653189 TTGAAGAAGGAGCTAGGGGCCGG + Intergenic
933203178 2:79474883-79474905 CTGGAGCAGGATTAGGGTGCTGG - Intronic
933661725 2:84933056-84933078 AAGAAGAAGAAGTAGGGGGCAGG + Intergenic
933778859 2:85787803-85787825 CTGAGGAAGGAGTAGAGGCTGGG + Exonic
933969630 2:87459730-87459752 CTCAGGAAGGAGGAGTGGGCAGG + Intergenic
934572457 2:95381696-95381718 CCAAAGAGGTAGTAGGGGGCTGG + Exonic
935847897 2:107187085-107187107 CTGAAGGAGGAGGAGGAAGCTGG + Intergenic
936324156 2:111490767-111490789 CTCAGGAAGGAGGAGTGGGCAGG - Intergenic
937098110 2:119248711-119248733 CTGAACAAGGAGGGGGTGGCAGG + Intronic
937426796 2:121806654-121806676 TTGAAGATGGAGGAAGGGGCTGG + Intergenic
938157898 2:128957157-128957179 CTGCAGAAGGAGCAGAGGTCTGG - Intergenic
939914293 2:148020847-148020869 CTTAGGAAGGAGGAGGGAGCTGG + Intronic
940136970 2:150447984-150448006 CTCCAGAAAGAGGAGGGGGCTGG - Intergenic
942171897 2:173297643-173297665 CTGGTGCAGGAGTAGGGGGCCGG + Intergenic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942251837 2:174053882-174053904 CTGGAAGAGAAGTAGGGGGCGGG + Intergenic
944214041 2:197236120-197236142 CTGCAGAAGGAGTAGGGTTGAGG - Intronic
944425047 2:199572272-199572294 CTGAAGGAGGAGCGGGGGGGCGG + Intergenic
945061795 2:205915812-205915834 TTGAAGATGGAGGAAGGGGCAGG - Intergenic
946306159 2:218858218-218858240 CTAAAGAAGGGGAAGGGGGCAGG - Intergenic
946740106 2:222792868-222792890 GTGAAGAAGGAGGAGGAGGAGGG - Intergenic
947783639 2:232794134-232794156 CTTAAGAAGGAAAAGGGGGATGG - Intronic
948021348 2:234736312-234736334 CTGGAGTAGGGGAAGGGGGCAGG - Intergenic
948078989 2:235190079-235190101 CCGAAGGAGGAGATGGGGGCAGG - Intergenic
948227021 2:236319109-236319131 ATGAAGAAGGAGGAGGGGCATGG - Intergenic
948271741 2:236678910-236678932 CTGGAGCAGGGGTAAGGGGCAGG + Intergenic
948599064 2:239097708-239097730 CTGAAAAAGGAGGAGGGCGTGGG + Intronic
948892891 2:240915824-240915846 CTGAAGAAGGTGCTGGGGGCAGG + Intergenic
1168889624 20:1286408-1286430 CTGGAGAGGGAGAAGGGAGCTGG + Intronic
1169119759 20:3088186-3088208 GTGAAGAAGGGGTAAGGTGCTGG - Intergenic
1169637004 20:7703369-7703391 GTGGACAAGGACTAGGGGGCAGG - Intergenic
1170045877 20:12084942-12084964 TTGAAGATGGAGGAAGGGGCCGG - Intergenic
1170664858 20:18378050-18378072 ATGAAGAAGGAGATGGGGGAAGG + Intergenic
1171119928 20:22559264-22559286 ATGAGGAAGGAGTATGGGCCTGG - Intergenic
1171479889 20:25446328-25446350 TAGAAAAAGGAGTAGGGGCCGGG - Exonic
1172038694 20:32028779-32028801 AGGAAGAAGGAGAAGGGGGGTGG + Intronic
1172223769 20:33290856-33290878 CTGAGGAAGGAGGTGAGGGCTGG + Intronic
1172474684 20:35227375-35227397 CTGGAGAAGGGGGAGGGGGAGGG + Intronic
1172486111 20:35298695-35298717 CTGAAGATGTATTTGGGGGCAGG - Intergenic
1172555226 20:35834978-35835000 CTCAAGAAGAGGTAGGAGGCCGG + Intronic
1172623937 20:36336847-36336869 CCCAGGAAGGAGAAGGGGGCTGG - Intronic
1172692930 20:36803079-36803101 CTGAAGACAGGGAAGGGGGCCGG - Exonic
1173144899 20:40515991-40516013 CTGAAGAAGGAGCTGGGCGAGGG - Intergenic
1173346393 20:42204674-42204696 CTGAGGGAGGGGTAGGTGGCAGG + Intronic
1173620163 20:44430338-44430360 CTGAAGAAGGAGGATGAGGTTGG - Exonic
1173626818 20:44479083-44479105 ATGAAAAAGAATTAGGGGGCCGG - Intronic
1174287526 20:49483465-49483487 GAGAAGGAGGAGAAGGGGGCGGG - Intergenic
1174543278 20:51306451-51306473 TTGAAGCAGGAGCATGGGGCTGG + Intergenic
1174776496 20:53347492-53347514 TTGAATAAGGAGTTGGGGGGTGG - Intronic
1175030339 20:55947280-55947302 CTCAAGAAGGAGGAGGGGACGGG + Intergenic
1175431464 20:58907338-58907360 TTGAAGAAGGAGTGGGGGCTGGG - Intronic
1175764138 20:61581452-61581474 ATGAAGATGGAGGAGGGGCCAGG - Intronic
1175963163 20:62647274-62647296 CTGAAGATGGTGTGGGGAGCAGG + Intronic
1177240034 21:18444124-18444146 CTGAAGTAGGACTACGAGGCTGG - Intronic
1178368075 21:32004291-32004313 CTGATGAAGGAGTCAGGGGAAGG - Intronic
1178724122 21:35036074-35036096 CAGAAGAGGGAGCAGGGAGCAGG + Intronic
1178982144 21:37273570-37273592 GTGGAGAAGGAGGAGGGGGGAGG + Intergenic
1179593575 21:42427563-42427585 CTGTAAAATGGGTAGGGGGCAGG - Intronic
1179732762 21:43376632-43376654 ATGCAGGTGGAGTAGGGGGCAGG - Intergenic
1179981990 21:44900478-44900500 GAGAAGAAGGCGTGGGGGGCAGG + Intronic
1181536525 22:23549133-23549155 CTGCACATGGGGTAGGGGGCAGG + Intergenic
1181716938 22:24737862-24737884 GTGTAGAAAGAGAAGGGGGCCGG + Intronic
1182843246 22:33409288-33409310 CGGAAGGAGGAGGAGGAGGCTGG + Intronic
1183309395 22:37101282-37101304 CTGAAGCAGGAGACAGGGGCAGG + Intronic
1183778819 22:39985410-39985432 CCGAAGAAGGAGAAAGGTGCAGG - Intergenic
1183939588 22:41285874-41285896 GTGAAGAAGGCCGAGGGGGCAGG + Intronic
1184939189 22:47748511-47748533 CTGGAGGAGGAGGAGGGTGCAGG + Intergenic
1185045139 22:48524963-48524985 CTGAAGATGGAGGAAGAGGCAGG - Intronic
1185263637 22:49885745-49885767 CTGGAGAAGTAGGAAGGGGCGGG - Exonic
949572185 3:5304093-5304115 CTGAAGGAGGGGATGGGGGCAGG + Intergenic
950434151 3:12968353-12968375 GTGGAGAAAGGGTAGGGGGCTGG - Intronic
950708193 3:14796760-14796782 CTGAGAAAGGAGGAGGGAGCTGG - Intergenic
951366305 3:21787451-21787473 CTGGATAAGGAGTAGGGGCACGG - Intronic
951862939 3:27274086-27274108 CTAAACAAAGAGTAGGCGGCAGG + Intronic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952490206 3:33863425-33863447 GTCAAGAAAGAGTAGGGGGTGGG - Intronic
952945738 3:38477065-38477087 CTGCAGAATGAGGTGGGGGCTGG + Intronic
953480677 3:43249111-43249133 CTGATGAAGGAGTGTGGGGTGGG - Intergenic
953980115 3:47409394-47409416 CTGAGGAAGGGGTGGGGGCCAGG - Intronic
953990125 3:47477068-47477090 CTGAAGAATGTGTAGTGGGTCGG - Intronic
954064058 3:48091690-48091712 CTGAAGCAGGAGCAAGGGGAAGG - Intergenic
954129451 3:48552701-48552723 CTGAAGGAGCAGTTGGGGGGTGG - Intronic
955205389 3:56891311-56891333 CTAAAAATGGAGTAGGGGCCAGG - Intronic
955406902 3:58631321-58631343 CTGAGGAAGGAGTGGGAAGCTGG + Intergenic
956292019 3:67670473-67670495 AGGAAGAAGTAGTTGGGGGCTGG + Intergenic
956376844 3:68622243-68622265 CTGAAGAAGGAGTATGTGAATGG - Intergenic
956553012 3:70482958-70482980 CTGGAGAATGAGAAAGGGGCTGG + Intergenic
957531977 3:81452011-81452033 CTGAAGAAAGACTTGGGGGTGGG + Intergenic
959007841 3:101040520-101040542 CTGAGGAATGAGGAGGGAGCTGG - Intergenic
960826183 3:121787116-121787138 CTGAAGAAGGAGTAGGAGACAGG + Intronic
960972665 3:123150700-123150722 CTGGAGAAGGAAGAGGGGGCGGG - Intronic
960992807 3:123322898-123322920 CTGAAGCAGGGATGGGGGGCTGG - Intronic
961078361 3:124002989-124003011 CTGCTGAAGGAGGTGGGGGCGGG - Intergenic
961726428 3:128933892-128933914 ATGAAGGAGGAGGAGGAGGCTGG - Intronic
961754955 3:129121928-129121950 CTGAGGGCGGAGTCGGGGGCGGG - Intronic
962051558 3:131821095-131821117 CTGAAGGAGGAGGAGGAGGTTGG + Intronic
962207714 3:133448638-133448660 ATGAAGAGGTAGGAGGGGGCTGG + Exonic
962254507 3:133861113-133861135 CTGCAGAAGGGGAAGGGGGCTGG + Intronic
963646823 3:147925335-147925357 CTGGAGAAGGAGCTGGGAGCTGG + Intergenic
963960637 3:151305239-151305261 CTGAAGGAACAGTAGGTGGCAGG - Intronic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
966362758 3:179148284-179148306 CGGAGAAAGGAGTCGGGGGCGGG + Intronic
966391148 3:179453416-179453438 CTAAAGAAAGAATATGGGGCCGG - Intergenic
966920080 3:184605335-184605357 CTGAAGAAGGCCTAGTGGGTGGG + Intronic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968534178 4:1113203-1113225 GTGGAGAAGGGGGAGGGGGCAGG - Intronic
968648207 4:1750172-1750194 CTGCAGAGAGAGGAGGGGGCGGG + Intergenic
968727306 4:2253733-2253755 CTGAAGAAGGAGGGGGCTGCTGG + Intronic
968762310 4:2449130-2449152 ATGAAGGAGCAGGAGGGGGCCGG - Intronic
968889748 4:3362161-3362183 GTGAAGGAGGGGTAGGGTGCTGG + Intronic
968939830 4:3631993-3632015 CTGAAGAAAGGCAAGGGGGCTGG - Intergenic
969148092 4:5141811-5141833 CTGAGGAAGGTGGAGGGGGTGGG - Intronic
969540202 4:7784025-7784047 CTGAAGAAGGGCTCAGGGGCTGG + Intronic
969696516 4:8738138-8738160 CTGCAGGTGGGGTAGGGGGCAGG - Intergenic
969939858 4:10721176-10721198 CTGAGGAGGGAGTTGGGGGCTGG + Intergenic
970275202 4:14392171-14392193 CTGAAGAAGGAGCAGGGGCCAGG - Intergenic
970600415 4:17637320-17637342 CTGAAAAAGCAGTGGGGGCCGGG - Intronic
972374808 4:38460299-38460321 CAGAGGAAGAAGTAGGTGGCTGG - Intergenic
972458731 4:39279514-39279536 CTGAGGCAGGAGGAGGAGGCTGG - Intronic
973639384 4:52887821-52887843 CTGAGAAAGGAGTTGGGGGATGG - Intronic
973796945 4:54437065-54437087 CTGGAGAAGGATTAGTGAGCTGG + Intergenic
975077855 4:70235297-70235319 CTGAAGAAGGAAGAGGTGGCAGG + Intergenic
976189733 4:82476670-82476692 TTGAGGAAGGAGTGGGGGGGCGG - Intergenic
976786100 4:88823333-88823355 GAGCAGAAGGAGTAGGGTGCGGG - Intronic
977971088 4:103215277-103215299 TGGAAAAAGTAGTAGGGGGCTGG + Intergenic
978847545 4:113292111-113292133 CTTAAGAAGGTGAAGGGGGTGGG - Intronic
979441943 4:120760276-120760298 ATCAAGAAAAAGTAGGGGGCAGG + Intronic
979602995 4:122606615-122606637 CTGGAGCAGGAGGAGCGGGCAGG - Intergenic
980876959 4:138671239-138671261 CTGCAGGAGGACTAGAGGGCAGG + Intergenic
981041637 4:140228244-140228266 ATGAAGAAGGAGGAGGAGGAGGG - Intergenic
983559144 4:169083922-169083944 CTGAAGAGAGTGTTGGGGGCTGG + Intergenic
985386560 4:189453721-189453743 CTGAAGAAGGAGAAGGGAATTGG + Intergenic
985652212 5:1112384-1112406 CTGGAGCAGGAGTGGGGGGTCGG - Intergenic
985652302 5:1112618-1112640 AAGAAGGAGGGGTAGGGGGCTGG - Intergenic
987243097 5:16021130-16021152 TTGAAGATGGAGGTGGGGGCAGG - Intergenic
987247058 5:16059806-16059828 CTGAAGAGGGCGGAGGGGGTGGG - Intergenic
987472491 5:18350551-18350573 CTGACGAAGGATTAGGAGGCAGG - Intergenic
989624920 5:43420134-43420156 CTGAGGAAGGAGGAGTGGGGCGG - Intergenic
989633947 5:43514899-43514921 CTGAAGAAGCAGTGGTGGGCAGG - Exonic
991018920 5:61959798-61959820 CTGAAGTAAGAGTAGGAGGCAGG - Intergenic
992233426 5:74685116-74685138 CTGGAGGCGGAGTCGGGGGCGGG + Intronic
992233572 5:74685726-74685748 CTTAAGAAGCAGTAGGAGGGTGG - Intronic
992587905 5:78260289-78260311 CTAAAGAATGAGGAGGGGCCGGG + Intronic
992604781 5:78444138-78444160 CTAAAGAGGGAATATGGGGCTGG + Intronic
993321364 5:86471709-86471731 CTGAAGAAGAGGTGGGGGTCAGG + Intergenic
995609765 5:113897027-113897049 CTGAATAACAAGTGGGGGGCAGG + Intergenic
997803273 5:136888423-136888445 CTGGAGAAGGAGGATAGGGCTGG + Intergenic
998364131 5:141618220-141618242 CCAAAGAAGGAGTTGGGGGTAGG + Intronic
998371325 5:141663583-141663605 CTGAAGAAAGAATATGGGGCCGG - Intronic
999495126 5:152089318-152089340 CTGATGAAGAATTAGGAGGCTGG - Intergenic
999710688 5:154315716-154315738 CTGAAGAAGGAGTCCTGGGTGGG - Intronic
1000354782 5:160384012-160384034 ATAAAGAAGGAATATGGGGCTGG + Intergenic
1001504986 5:172271491-172271513 TTCAAGGAGGAGTGGGGGGCAGG - Intronic
1001547088 5:172577025-172577047 CTGATGAAAGAGTAGGGTGAGGG + Intergenic
1001877307 5:175212776-175212798 CGTAAGAAGGAGTTGGAGGCCGG + Intergenic
1001902189 5:175441877-175441899 CTGAAAAAGGAGGAGGCAGCTGG - Exonic
1002069008 5:176667801-176667823 CTGAAGTGGGAGCACGGGGCTGG + Intergenic
1002193136 5:177489254-177489276 CTGGAGTAGGAGTAGGGACCTGG - Intronic
1002194427 5:177494552-177494574 CTGGAGAGGGGGTGGGGGGCGGG + Intronic
1002532802 5:179858696-179858718 CCGGAGGAGGAGGAGGGGGCTGG + Intronic
1002689727 5:181042342-181042364 CTGGGGAAGGAGTAAGGGACTGG - Intronic
1002972802 6:2041610-2041632 CTGAAGAAGAGGTGGGGAGCAGG + Intronic
1003407961 6:5838928-5838950 CTGGAGAATGAGGATGGGGCGGG + Intergenic
1004118134 6:12791195-12791217 CTGCAGAAGGAGAAGGAAGCAGG + Intronic
1004350874 6:14889287-14889309 CTGAGGCAGGAGGATGGGGCAGG - Intergenic
1004362130 6:14980531-14980553 CTCAAGAAAGGGTGGGGGGCGGG - Intergenic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1004461721 6:15842825-15842847 CTTATGAAGGAGCATGGGGCAGG + Intergenic
1004629499 6:17407845-17407867 ATGAAGAAGCAAAAGGGGGCTGG + Intronic
1004784741 6:18955121-18955143 ATGAAGAAGGAGAAGGGGCTGGG - Intergenic
1006154369 6:32006343-32006365 CTGCAGGAGGAGCTGGGGGCTGG - Intergenic
1006160676 6:32039071-32039093 CTGCAGGAGGAGGTGGGGGCTGG - Intronic
1006175782 6:32120745-32120767 CTGAAGAAGGAGAAAAGGGCCGG - Intronic
1006823042 6:36913781-36913803 CTGAGGAGGGAGTAGAGGACAGG - Intronic
1006976936 6:38111518-38111540 ACGAAGGAGGAGTGGGGGGCTGG - Intronic
1007114119 6:39331158-39331180 AAGAAGAAGGAGTTGGGGGTGGG - Exonic
1007326176 6:41061692-41061714 CTGAAGAAGCTGAAGGAGGCTGG + Exonic
1007748252 6:44056484-44056506 CTGAAGAAGGAGAAAGGAGATGG + Intergenic
1008014235 6:46500539-46500561 TTGAAGAAGTAGGAGGAGGCTGG - Intergenic
1008292612 6:49736329-49736351 CTGTGGAAGGAGTAGGCGGCTGG - Intronic
1008547298 6:52594478-52594500 CTGAACAAGGGGTAGGGAACAGG + Intergenic
1008810688 6:55494031-55494053 CTAAAGAATGAGAAGGGGCCAGG - Intronic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1011847384 6:91582912-91582934 CTGAGGATGGAGTTGGGGGATGG + Intergenic
1012548926 6:100450196-100450218 TGGAAGCAGGGGTAGGGGGCTGG - Intronic
1012985113 6:105867365-105867387 CTGAAGGAGGAATAGGAGTCTGG + Intergenic
1013601991 6:111713540-111713562 CTGAAGAAAGTGTGGGGGGGTGG - Intronic
1014795506 6:125719833-125719855 CTGAGAAAGGAGTTGGGGGTAGG + Intergenic
1015275285 6:131377741-131377763 TTGAAGAAGGAGAAAGGGGAGGG - Intergenic
1016037168 6:139395414-139395436 CTCCAGAGGGAGTTGGGGGCTGG + Intergenic
1016283962 6:142451795-142451817 CTGAGGAAGGGGTAGTGGGGAGG - Intergenic
1016747379 6:147595484-147595506 CTAAAAACGGAGTAGGGGGTGGG - Intronic
1016799420 6:148153610-148153632 CTAAAGAAGGAGGAGGGGAATGG + Intergenic
1016811258 6:148263217-148263239 CCGAAGAAGCAGAAGGTGGCAGG + Intergenic
1017081495 6:150673663-150673685 CTGAAAAAGGAGGAGAGGGAGGG - Intronic
1018096804 6:160394730-160394752 CTGAAGAAGAAGGAGAGGACAGG + Intronic
1018336172 6:162792302-162792324 CAGAAATAGGAGTAAGGGGCAGG + Intronic
1018484861 6:164230797-164230819 CTAAAGAAGGAGTTGCTGGCCGG + Intergenic
1018496444 6:164351178-164351200 CTTAAGAAGGAGGAGTGGGAGGG + Intergenic
1018762715 6:166905527-166905549 CTGAAGAGGGATAGGGGGGCTGG + Intronic
1018850820 6:167589078-167589100 CTGAAGGAGGAGGATGGAGCAGG - Intergenic
1019101523 6:169634761-169634783 CTGAAGAAGGAGGACGGCGTGGG - Intronic
1019595179 7:1855039-1855061 CTGAAGAAGGCATCGGCGGCTGG + Intronic
1019701362 7:2476331-2476353 CTGGAGAAGGAGAACGGTGCAGG - Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020032860 7:4945070-4945092 CAGAAGAAGGGGTCGGGGGGAGG - Intronic
1020354311 7:7260203-7260225 GTGATGATGGAGAAGGGGGCCGG - Intergenic
1020361223 7:7328821-7328843 CTGAAGTAGGAGTTGGTGGAAGG - Intergenic
1021483705 7:21145334-21145356 CTGGAGAAAGACTAGGTGGCAGG - Intergenic
1021510417 7:21427687-21427709 CTGGGAAATGAGTAGGGGGCGGG + Intergenic
1022573316 7:31474379-31474401 CTGGGGTGGGAGTAGGGGGCAGG - Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023528922 7:41133573-41133595 CAGAAGAAGGGGGTGGGGGCGGG + Intergenic
1024030303 7:45455047-45455069 CGGATGAGGGAGTAGGGGGATGG - Intergenic
1024512195 7:50212990-50213012 CTGGAGAAAGAGTGGGAGGCAGG + Intergenic
1025142593 7:56478524-56478546 CTGCAGAAGGAGCAGGGCTCTGG + Intergenic
1025610805 7:63074050-63074072 CTGCAGAAGGAGCAGGGCTCTGG - Intergenic
1025708654 7:63889125-63889147 CTGCAGAAGGAGCAGGGCTCTGG + Intergenic
1026342681 7:69447782-69447804 CTGAGGAAAGACTAGGGGCCGGG - Intergenic
1026499946 7:70935629-70935651 CTGAATAAGGAAGAGGGGGCAGG - Intergenic
1026558610 7:71429263-71429285 CTGAAGAAGGAGGCGTGGGTGGG + Intronic
1027132246 7:75599325-75599347 CTGGAGGAGGAGAAAGGGGCGGG - Intronic
1028559689 7:92160523-92160545 CTTAAGAATGAATAGGCGGCTGG + Intronic
1029710370 7:102295925-102295947 CTGAACAATGAGTTGGGGGCAGG - Intronic
1029917824 7:104230661-104230683 CTGACCAAAGAGGAGGGGGCAGG + Intergenic
1030104518 7:105975764-105975786 TTGAGGAAGGAGGTGGGGGCAGG - Intronic
1031423763 7:121581177-121581199 CTAAAGAGTGAGTAGGGGCCAGG - Intergenic
1031894652 7:127335294-127335316 CTGGGGAAGGAATAGGGGGTGGG + Intergenic
1032062347 7:128735631-128735653 CTGGAGCAGGAGGAAGGGGCGGG + Intergenic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1033295723 7:140132744-140132766 CTGCATAAGGATTAAGGGGCAGG + Intronic
1033356833 7:140607122-140607144 CTGAAGAAGGAGTTGGGAGAGGG - Intronic
1033614850 7:143004234-143004256 CTGGAGGAGGAGGAGGGGGTTGG + Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034562386 7:151889465-151889487 CTGCAGAAGAAGTAGGGGCCAGG + Intergenic
1034967582 7:155400729-155400751 CTGCAGAGGGAGTGGGGGACAGG - Intergenic
1035053829 7:156020357-156020379 TTGGAGCAGGGGTAGGGGGCAGG + Intergenic
1035087757 7:156275822-156275844 CTGAAGAATGAGGAGGGACCAGG - Intergenic
1035115634 7:156520956-156520978 CTGAAGAAGGGGAAGGGGAGTGG + Intergenic
1036295957 8:7537433-7537455 CAGAGGAAGGAGTATGTGGCCGG + Intergenic
1036326609 8:7783586-7783608 CAGAGGAAGGAGTATGTGGCCGG - Intergenic
1036521684 8:9497769-9497791 CTAAAGAAGGAGGAGGAGGAAGG - Intergenic
1036560049 8:9894098-9894120 CTGAGGTAGGAGTAGAAGGCTGG + Intergenic
1038039226 8:23709982-23710004 CTGAAGTAGGAGGAGGGAGGAGG - Intergenic
1038677910 8:29640211-29640233 CTGAAGAAGGAGGATAGGGAAGG + Intergenic
1039244149 8:35589644-35589666 CTGAGCAAGGAGTATGGGGAAGG - Intronic
1041267607 8:56080332-56080354 AAGAAGAAGGAGGAGGGGGAGGG + Intergenic
1042364991 8:67925471-67925493 CTCAAGACCAAGTAGGGGGCAGG + Intergenic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1045720262 8:105101579-105101601 CTCAGGAAGGAGTAGGGAGTTGG + Intronic
1047167917 8:122461311-122461333 CTGAGTAAGAAGGAGGGGGCTGG + Intergenic
1047454694 8:124998395-124998417 CAGGAGCAGGGGTAGGGGGCGGG + Intergenic
1048892786 8:138962863-138962885 CTGAAGGAGGAGTTAGGGGGAGG - Intergenic
1049085454 8:140474889-140474911 CATAAGATGGAGGAGGGGGCTGG + Intergenic
1049600311 8:143504497-143504519 CCAAAGACGGAGGAGGGGGCAGG - Intronic
1050461795 9:5883765-5883787 CCTAAGAAGGAATAGGGGGTGGG - Intronic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051287732 9:15513388-15513410 CTGAAGCAAGGGGAGGGGGCAGG + Intergenic
1051445493 9:17135241-17135263 GTGAAGAAGGGTCAGGGGGCCGG + Exonic
1052469021 9:28869428-28869450 ATGAACAAGGAGTGGGGGGAGGG + Intergenic
1052685756 9:31753523-31753545 CTCAAGAAGAAGGAGGGGGAGGG - Intergenic
1053269486 9:36740269-36740291 CTGAAGCAAGGGCAGGGGGCAGG - Intergenic
1054450930 9:65403317-65403339 CTGAAGAAAGGCAAGGGGGCTGG + Intergenic
1054894488 9:70293337-70293359 CTAAAAAAAGAGTAGGGGGGTGG - Intronic
1055580807 9:77704541-77704563 CTGTTGGAGGAGTAGGGGGAAGG + Intergenic
1056275036 9:84986201-84986223 CTGAATATGGAGCAGGGGTCGGG - Intronic
1056565756 9:87771311-87771333 CCGAGGCAGGAGTTGGGGGCGGG - Intergenic
1056671113 9:88627585-88627607 CTGAAGGAGGATTGGGGGGAAGG + Intergenic
1057037099 9:91818918-91818940 CTGCAGAAGAGGGAGGGGGCAGG - Intronic
1057140811 9:92725835-92725857 CCCAAGAAGGAGTAGGGTGAAGG - Intronic
1057354326 9:94321852-94321874 CTAAAGACAGAGTGGGGGGCAGG - Intronic
1057392658 9:94652596-94652618 CTGAATATGGAGCGGGGGGCGGG - Intergenic
1057653437 9:96935783-96935805 CTAAAGACAGAGTGGGGGGCAGG + Intronic
1057759418 9:97860575-97860597 CAGAAGAGGGAGTGTGGGGCTGG - Intergenic
1058644047 9:107114143-107114165 CTGAAGAAGCACTCTGGGGCTGG - Intergenic
1058716018 9:107722549-107722571 TTGAAAAAGAAGTAGGGGCCAGG - Intergenic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059269127 9:113061204-113061226 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059270263 9:113066653-113066675 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059271399 9:113072103-113072125 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059272530 9:113077547-113077569 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059273665 9:113082989-113083011 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059274801 9:113088435-113088457 CTGGAGAAAGAGGAGGGGGTGGG - Intergenic
1059621511 9:116010991-116011013 CTGAAGAAGGTGAAGGGACCAGG + Intergenic
1059744451 9:117186446-117186468 CTGAAGCAGGAGAATGGTGCGGG + Intronic
1060143307 9:121229174-121229196 CTGAAGACAAAGTAGGGGGAGGG - Intronic
1061013994 9:127971528-127971550 CTGAAGAGGGAATGCGGGGCGGG + Intronic
1061458945 9:130720701-130720723 CTGAAGGAGGACAAGGGAGCAGG + Intronic
1061551075 9:131335025-131335047 CTGGAGAAGGAGTAGGGGTGGGG - Intergenic
1061932397 9:133839990-133840012 CTGAAGATGGCCTCGGGGGCGGG - Intronic
1062131589 9:134897185-134897207 CTGGAGATGGAGTGGGAGGCAGG - Intergenic
1062374442 9:136255626-136255648 CTGAAGGAGGGGCTGGGGGCTGG + Intergenic
1062651822 9:137581697-137581719 CTGCAGATGGTGGAGGGGGCTGG - Intergenic
1185726184 X:2423737-2423759 ATGGAGACGGAGTGGGGGGCGGG - Intronic
1187013278 X:15301730-15301752 TTGAAAAATGAGTAGGGGCCTGG - Intronic
1187120460 X:16400861-16400883 CAGAAGATAGAGTATGGGGCTGG - Intergenic
1187377096 X:18764689-18764711 GTGAGGAAGGAGGAGGGGGCAGG + Intronic
1189206468 X:39243508-39243530 CTGAACAGGGAGTAGGGAGACGG - Intergenic
1189340292 X:40199974-40199996 CGGAAGAAGGTGCAGGGGGCCGG - Intergenic
1189650840 X:43187938-43187960 AAGAAGAAGTAGAAGGGGGCAGG + Intergenic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1191667044 X:63714234-63714256 CTGAAGAAGGAGTAGGGGGCAGG - Intronic
1191865244 X:65698568-65698590 CAGCAGAAGCAGTGGGGGGCAGG - Intronic
1195693982 X:107653196-107653218 CTAAAGCAGGGGTAGGAGGCTGG + Intergenic
1196437461 X:115687953-115687975 CTAAAAAAGGTGTCGGGGGCGGG + Intergenic
1196544672 X:116947770-116947792 CTGAAGATGGTGAAGGGGGAAGG + Intergenic
1199045569 X:143167319-143167341 CTGAAGAAGCAGAAGGAGGGTGG + Intergenic
1199166268 X:144679203-144679225 CTGAAGATGGCGAAGGGGGAAGG - Intergenic
1199186336 X:144919875-144919897 CTGAAGATGGTGAACGGGGCAGG + Intergenic
1199193840 X:145003745-145003767 CTGAAGATGGAGAAGGAGGAGGG + Intergenic
1199730139 X:150623637-150623659 CTGAAGAAGGCAGAGGGGGATGG + Intronic
1200006901 X:153091989-153092011 TTGAACAAAGAGCAGGGGGCAGG - Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200138161 X:153884973-153884995 CTCCAGAAGGAGTGGGGGCCTGG - Intronic
1200274295 X:154717368-154717390 CTGGAGATGGAGTGGGGGGTGGG + Intronic