ID: 1191668938

View in Genome Browser
Species Human (GRCh38)
Location X:63731209-63731231
Sequence GGGGGCCTTCTGAGAGGATA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191668938_1191668944 0 Left 1191668938 X:63731209-63731231 CCGTATCCTCTCAGAAGGCCCCC 0: 1
1: 0
2: 1
3: 25
4: 174
Right 1191668944 X:63731232-63731254 TTCTCCTGAACAGCTAAACTTGG 0: 1
1: 0
2: 0
3: 7
4: 158
1191668938_1191668945 1 Left 1191668938 X:63731209-63731231 CCGTATCCTCTCAGAAGGCCCCC 0: 1
1: 0
2: 1
3: 25
4: 174
Right 1191668945 X:63731233-63731255 TCTCCTGAACAGCTAAACTTGGG 0: 1
1: 0
2: 0
3: 8
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191668938 Original CRISPR GGGGGCCTTCTGAGAGGATA CGG (reversed) Intronic
900571321 1:3359924-3359946 GGCGGCCTTCTGTGAGGAGCTGG - Intronic
901479012 1:9511385-9511407 AGGGGACTTCTGAGAGGAAAAGG - Intergenic
901878735 1:12181668-12181690 AGGCGACTTCTGAGAGGAAAGGG - Intronic
903125074 1:21242282-21242304 GGGAGCCTGCTGTGAGGAAACGG - Intronic
903982450 1:27199175-27199197 AGGGGACTTCTGAGAGGAAAAGG + Intergenic
904376502 1:30085478-30085500 GGAGGACTTCTGAGAGGAGGTGG + Intergenic
904571053 1:31465495-31465517 GAGGGCCATCTGAGTGGAAAGGG - Intergenic
904674847 1:32192615-32192637 TGGGGGCTTCTGACAGGATCTGG + Intronic
904747567 1:32720459-32720481 GGGGACCTAGTGAGAGGATGAGG + Intergenic
905647273 1:39633270-39633292 CGGGGCCTTCTGGGAGGCCAGGG - Intronic
906215171 1:44034315-44034337 GGGGGCCTGCTGAGAAGGTGGGG + Intergenic
906726373 1:48047495-48047517 GGGAGCCTTTTCAGAGGATGTGG + Intergenic
910262308 1:85304296-85304318 GGGGCCCTTCTGAGGGGAGGGGG + Intergenic
910675392 1:89811249-89811271 GGGAACCTTCAGAGAGGAGATGG - Intronic
912345757 1:108962081-108962103 GGGGCTTCTCTGAGAGGATAGGG + Intronic
913069629 1:115286926-115286948 GGGGCACTTCTGAGAGGGAAAGG + Intronic
913715024 1:121524854-121524876 GTGTGCCATCTGAGACGATATGG + Intergenic
914464796 1:147917339-147917361 CGGGGCAGTCTGAGAGAATACGG - Intergenic
915462980 1:156080975-156080997 GGGGGGCTGCTGAGAGGAGGGGG - Intronic
915904379 1:159867172-159867194 TGGGGTGTTCTGTGAGGATAGGG - Intronic
918044491 1:180933573-180933595 GGGTGCCTTCTGATAGAAAACGG + Intronic
919848845 1:201658879-201658901 GTTGGCCCTCTGAGAGGGTAGGG + Intronic
921185539 1:212666561-212666583 GAGCCCCTTCTGAGAGGGTAAGG + Intergenic
923610797 1:235491663-235491685 GGTGACCTTGTGAGAGAATAAGG - Intronic
1064721786 10:18236498-18236520 GGGGGCCTACTGAGGGGCTCTGG - Intronic
1068895296 10:62192229-62192251 GGGGGGCTACTGAGAGAATATGG + Intronic
1069644285 10:69981238-69981260 GAGGGACTTCTGAGAGGAAAAGG - Intergenic
1069769330 10:70887820-70887842 GAGGGCCTTTTGATAGGAGAGGG - Intronic
1070900928 10:80028513-80028535 GGGAGCCTGCTGTGGGGATATGG - Intergenic
1070902664 10:80044280-80044302 GGGAGCCTGCTGTGGGGATATGG - Intergenic
1073302587 10:102480156-102480178 GGGGGCCTTGGGAGAGTTTAAGG - Exonic
1074316378 10:112365082-112365104 GAAGGCCTTCAGAGAGGATCTGG + Intergenic
1075684263 10:124353140-124353162 GGCAGCCTTGTGAGAGGAGAAGG - Intergenic
1076585962 10:131547820-131547842 AGGGGCCTTCTCAGAGGAAAGGG + Intergenic
1077466433 11:2735819-2735841 GGGGTCCTTATGAGAGGAGAAGG - Intronic
1087266948 11:96071061-96071083 AGGGGCCTTCTGAGTGGAGAAGG + Intronic
1087866293 11:103230384-103230406 GTGGGTATTTTGAGAGGATAAGG + Intronic
1089654971 11:119940690-119940712 AGGGGCCTCCTGAGAGGAGTAGG + Intergenic
1091370078 11:135050382-135050404 GGGGGAGTTCTGAGGGGAAAAGG - Intergenic
1092046371 12:5433845-5433867 GAGGGCCTGCTGAGAGGGGAGGG + Intronic
1092241010 12:6836696-6836718 AGGGGGCCTCTGAGAGGGTAGGG - Intronic
1097922208 12:65088385-65088407 GGGGCCAGTCTCAGAGGATATGG - Intronic
1100613177 12:96208991-96209013 GGGATCCTTCTGAGAGGAAGGGG + Intronic
1101345541 12:103882900-103882922 GGGAGCCTTCTCAGAGGAGGGGG - Intergenic
1105290602 13:19050780-19050802 TGGGGGCATCTGAGTGGATAGGG - Intergenic
1109380428 13:61552062-61552084 GTGGTCCTTGTGAGATGATATGG + Intergenic
1114592040 14:23874937-23874959 GGGGCCTTTCTGAGAGTAGAGGG + Intergenic
1115704654 14:35986705-35986727 GGGAGCCCTGTAAGAGGATATGG - Intergenic
1118284591 14:64460195-64460217 GGGGACCTCCTGAGAGGGTTGGG + Intronic
1119936019 14:78593358-78593380 GGAGGCCTTCTGAGAGGCCAGGG + Intronic
1120073711 14:80132452-80132474 GGGGCACTTCTGAGAGTAAAAGG + Intergenic
1121358222 14:93232391-93232413 GGGGGTCTTCAGAGAGGGTGAGG - Intergenic
1125418038 15:39473959-39473981 AGTGGCCTTCTAAGAGGAAAGGG + Intergenic
1126175393 15:45730875-45730897 GAGGGCCCTCTGAGAGGGCAGGG + Intergenic
1126352226 15:47756244-47756266 AGGGGCATTCTTAGAGGATAAGG - Intronic
1128466273 15:67915149-67915171 GTGGGGCTTCTGAGAGGCTGGGG - Intergenic
1128616689 15:69115831-69115853 GGGGGCCTTCCCAGAGGAGATGG - Intergenic
1129226335 15:74172611-74172633 GGAGGGCTACTGAGGGGATACGG + Intergenic
1130770005 15:86914796-86914818 AAGGGCCCTCTGAGAGGTTATGG + Intronic
1130905826 15:88240384-88240406 GGGGACATTCTGTGAGGATGTGG + Intronic
1133371553 16:5249241-5249263 GGGGGCCTTCAGGAAGGATGGGG + Intergenic
1134202938 16:12213917-12213939 GGTGGCCTTGTGGGAGGATGAGG + Intronic
1134905933 16:17979794-17979816 GGGGCTCTTGTGGGAGGATAGGG - Intergenic
1135224551 16:20644365-20644387 GGGGCCATTCTGTGAGGAAAAGG + Intronic
1137512602 16:49114760-49114782 GGGAGGCTTCTGAGAGGAGGTGG - Intergenic
1139595896 16:67958107-67958129 GGGGGCCTGCTGAGTGACTAGGG - Intronic
1140925864 16:79582882-79582904 GGGGGCCTTCAGTGAAGATGGGG + Intergenic
1141841109 16:86574697-86574719 GGGGCCCTCCAGAGAGGAGAGGG - Intergenic
1143671466 17:8398967-8398989 GGGGACCTCCTGAGAGGACTGGG - Intergenic
1144695969 17:17303921-17303943 GGTGGCCCTCTGATAGAATAGGG + Intronic
1144784771 17:17825409-17825431 GGGGGCCTTCCAAGAGGAGGGGG + Intronic
1146063388 17:29618437-29618459 GGGTGCCGGCTGAGAGGAGAGGG + Intronic
1147745475 17:42691918-42691940 GGGGGTCTTCCTAGAGAATATGG + Exonic
1148671410 17:49413329-49413351 GAGGGCCTTCTCTGAGGATTTGG - Intronic
1148678492 17:49459070-49459092 AGGGGCCTTCCTAGAGGAGAAGG + Intronic
1149380147 17:56085472-56085494 TGGAGCCTTCTGAGAGAGTATGG + Intergenic
1151306070 17:73263360-73263382 TGGGGCCATCTCTGAGGATAGGG - Intergenic
1151676932 17:75603376-75603398 GGGGTCCTTCTGATTGGAGATGG + Intergenic
1152007099 17:77689184-77689206 ATGGGGCTTCTGAGAGCATAAGG + Intergenic
1152031376 17:77845583-77845605 GGGGGCTGACTGAGAGGAAAAGG - Intergenic
1152570327 17:81118844-81118866 GGGGGCCTTCTCCGAGGAGGTGG + Intronic
1153967151 18:10192290-10192312 GGTGTCCTTCTGAGAGAAAAGGG + Intergenic
1154142670 18:11838704-11838726 GGGATGCTTCTGAGAGGATGCGG + Intronic
1156787830 18:40937115-40937137 GGGAGACTTCAGAGAGGAGAGGG - Intergenic
1157678611 18:49586452-49586474 GGAAGGCTTCTGAGAGGCTATGG + Intronic
1160430892 18:78811852-78811874 GGGGCTCTTCGGGGAGGATAAGG + Intergenic
1162274157 19:9639780-9639802 AGGGGGCTTCTGAGATGATTGGG + Intronic
1162444190 19:10712443-10712465 GGGGCCATTCTGAGGGAATATGG + Intronic
1162819978 19:13216912-13216934 GGGGGGCTTGAAAGAGGATAGGG + Intronic
1163557773 19:18002141-18002163 GGGGGCCTTCTCTGAGAATCAGG - Intronic
1164467818 19:28502790-28502812 GGGGCCTTTGTGAGAAGATAAGG - Intergenic
1166123616 19:40700520-40700542 GGAGGACTTCTGAGAGCACAAGG - Intronic
1166301070 19:41912614-41912636 GTGGGTCTTCTGGGAGGGTACGG - Intronic
925012655 2:497126-497148 GGGCGGCTTCTGAGAGGCTGCGG - Intergenic
925020633 2:564963-564985 GGGGGCTGTGTGTGAGGATAGGG + Intergenic
925263835 2:2550671-2550693 GGGGCCCTTCAGTGAGCATAGGG + Intergenic
927612459 2:24555110-24555132 AGGGGACTTCCGAGAGGAAAAGG + Intronic
929149446 2:38734438-38734460 AGGGGACTTCCGAGAGGAAAAGG + Exonic
931534845 2:63263331-63263353 GGGGCCCTTAAGAGAGGATTAGG + Intronic
931798114 2:65731508-65731530 AGGAGACTTCTGAGAGGAAAAGG + Intergenic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
935949842 2:108318751-108318773 GGGGGCATGCAGAGAGGAAAGGG - Intergenic
937460807 2:122084044-122084066 GGGGGCCTTGGGAGATGATTAGG + Intergenic
938367863 2:130749316-130749338 AGTGGCCTGCTGAGAGGATGAGG - Intergenic
940069226 2:149666148-149666170 AGGGGAATTCTGAGAGGCTAAGG - Intergenic
946815278 2:223570880-223570902 GGGGGACATCTGAGAGGAAAAGG + Intergenic
947783300 2:232790684-232790706 GAGGGCCATCTGAGATGAGAAGG - Exonic
948547896 2:238745670-238745692 GGGGTCTTTCTGAGAGAAGAGGG + Intergenic
948609372 2:239157059-239157081 TGGAGCCATCTGAGAGGACAGGG - Intronic
1169044430 20:2524664-2524686 GGGGGCCTTCGCAGAGGATCTGG + Intronic
1169618094 20:7472348-7472370 GGTGTCCTTTTGAGAGGGTAGGG + Intergenic
1169793093 20:9432370-9432392 GGGGGCCTGAAGAGAGTATATGG - Intronic
1172170258 20:32926054-32926076 GGCGGCCTGCTGAGAGCACAGGG - Intronic
1172946445 20:38693175-38693197 GGGGGCCTGCTGGGAGGAGGGGG - Intergenic
1176246735 20:64100998-64101020 GGGGTTCTTCTGAGATGAAATGG - Intergenic
1178424533 21:32468906-32468928 GGGCGCCGTCTGAGTGGATTAGG + Intronic
1180671370 22:17556246-17556268 GAAGGCCTTCTGAGAGCATCTGG - Intronic
1181681330 22:24497685-24497707 GGAGGCCGTCTGTGAGGTTATGG + Intronic
950590965 3:13935563-13935585 GTGGGCCTGCTGGGAGGATGAGG + Intergenic
951412408 3:22380825-22380847 AGGGGGCATCTGACAGGATAGGG - Intergenic
953133297 3:40161411-40161433 GGTTGCCTGCTGAGAGGATGGGG - Intronic
953246252 3:41196498-41196520 GGGAGCCTTCCGAGGGGATTCGG + Intronic
955224925 3:57052789-57052811 GGTGTCCTTCTGACAGGAGAAGG - Intronic
955754047 3:62209983-62210005 GGTGGCCGTCTGATAGGTTAGGG + Intronic
956319860 3:67984743-67984765 GGTGTCCTTCTAAGAAGATAGGG - Intergenic
961981488 3:131083967-131083989 AAGGGCATTCTCAGAGGATATGG - Intronic
964825648 3:160824606-160824628 GGGTGCCATATGAGAGAATACGG + Intronic
969228386 4:5813682-5813704 GGGAGCCTTCTCAGAGGAGAAGG - Exonic
969315315 4:6378137-6378159 GGGGAGCTTCTGAGAGGGTCTGG + Intronic
969366018 4:6694647-6694669 AGGGGCCTTCTGTGAGGCTCAGG - Intronic
971236055 4:24843449-24843471 GGGGGCATTTGGAGAGGATGTGG - Intronic
981660260 4:147158294-147158316 GGGGGCCCTCTGAGAAGGAAGGG - Intergenic
982205634 4:152995471-152995493 TGGGGCCATCTGAGTGGAGACGG + Intergenic
983736849 4:171072351-171072373 AGGGGACTTCTGAGAGGAAAAGG - Intergenic
987762596 5:22185006-22185028 GGGGCCTTTCAGAGAGGGTAGGG - Intronic
988968804 5:36445587-36445609 GGGGGCCTCCTGGGAGGTGACGG - Intergenic
989039411 5:37211659-37211681 GGGGGCATTCTGTCAGGATAAGG - Intronic
989134551 5:38140667-38140689 GGAGGCATTCTCAGAGGATGGGG - Intergenic
989703430 5:44298232-44298254 GGGGGCCTTCGGAGGTGATTAGG + Intergenic
989997646 5:50854801-50854823 GGGGGCCTCCTGAGAGTGAATGG - Intergenic
991897387 5:71418391-71418413 GGGGCCTTTCAGAGAGGGTAGGG - Intergenic
992104368 5:73437464-73437486 GGCGGCCTTCTGCGAGGGGAAGG + Intergenic
993001490 5:82385736-82385758 GGTGCCCCACTGAGAGGATAGGG - Intronic
995348417 5:111147617-111147639 GGGGGCCTGCTGACAGGAACAGG + Intergenic
999044082 5:148448756-148448778 GGTGGCCTTCTTAGAGAAGAGGG + Intergenic
999119562 5:149198673-149198695 GGGGGCCTTTTGAGAGGAATTGG - Intronic
1001134930 5:169094646-169094668 GGGGGCATAGTGAGTGGATAAGG - Intronic
1002584118 5:180230731-180230753 GGGGGCCTTTTCATAGGAGAGGG + Intergenic
1004018816 6:11757810-11757832 TGGAGCCTTCTGAGAGAGTATGG + Intronic
1004887857 6:20069004-20069026 GGGGGCCTGCCGAGAGGAGCTGG + Intergenic
1005136759 6:22577657-22577679 GAGGGCCTACTGTGAGGATGGGG + Intergenic
1005254801 6:23989968-23989990 GTGGGCCTCCTGAGAGGACAGGG - Intergenic
1005390477 6:25327952-25327974 TGGGGCTTGGTGAGAGGATATGG + Intronic
1005703106 6:28423607-28423629 GGAGTTCTTCAGAGAGGATATGG - Intergenic
1006230744 6:32584408-32584430 GGCGGCCTCCTGAGAAGACACGG + Intronic
1006422971 6:33947085-33947107 GGGGACCTCCTGAGAGTAGATGG - Intergenic
1006518418 6:34557141-34557163 GGAGCCCTTCTGAGATGATTTGG - Intergenic
1006556419 6:34871035-34871057 GGGGCCCTTCTTGGAGGATGAGG + Exonic
1007107675 6:39294821-39294843 GGGGGACTTCTTGGAGGAAAAGG + Intergenic
1007118101 6:39358246-39358268 GATAGCCTTCTGGGAGGATAGGG - Intronic
1007353035 6:41288790-41288812 GGGGGCCTCCGGAGAGCAAAGGG - Intergenic
1008927919 6:56906675-56906697 AGGGGACTTCTGAGAGGAAAAGG - Intronic
1015154373 6:130075304-130075326 GGAGGGCTTCTTAGAGGACATGG + Intronic
1016469970 6:144364913-144364935 AGGGGCCTTCTAAGTGGAAAAGG - Intronic
1018732801 6:166665475-166665497 GGGGGTCTTCTCAGAGGGGAGGG - Intronic
1019023105 6:168935613-168935635 GAGGGGCTTCTGATAGGATAGGG + Intergenic
1019338166 7:494768-494790 GGGGGGCTTCTGTGAGGGAACGG + Intergenic
1020330805 7:7015160-7015182 AGGGGACTTCTGAGAGGAAAAGG - Intergenic
1020564299 7:9776893-9776915 GTTGCCCTGCTGAGAGGATATGG + Intergenic
1021698636 7:23297094-23297116 AGGGGCCATCTGAGAGAGTAGGG + Intergenic
1022538646 7:31114831-31114853 GGGGGCCTTCTGAAAGGGGAAGG - Intergenic
1022766784 7:33421733-33421755 TGAGGCCTTCTCAGAGGATGGGG - Intronic
1024360224 7:48460342-48460364 TGGAGCCTTCAGAGAGGACATGG - Intronic
1024656985 7:51459265-51459287 TGGGGCCTCCTGAGAGGGCAGGG - Intergenic
1028862747 7:95672019-95672041 GGGGCCCTTATGATAGGATTAGG + Intergenic
1029659453 7:101949882-101949904 GAGGGGCTTCTGAGAGGTGAAGG + Intronic
1036202547 8:6781216-6781238 GGGGGCTTTCTGAGGAGAAAGGG + Intergenic
1036812867 8:11879734-11879756 GAGGGTCTTCAGAGAGGATCAGG + Intergenic
1037730236 8:21517870-21517892 GGGGGCATTGGGAGAGGCTATGG - Intergenic
1038323224 8:26548470-26548492 AGGGGACTTCTGAGAGGAAAAGG - Intronic
1038426454 8:27467255-27467277 GGGTCCCTTCTGAGATGATCTGG - Exonic
1038596332 8:28890084-28890106 GGAGGCGTTCGGAGAGGAAAGGG - Intronic
1041185851 8:55299977-55299999 GGAGGCCTTCTGGGAGGGGAGGG + Intronic
1042021195 8:64372428-64372450 GTGGGACTTCTGGGAGGACAGGG - Intergenic
1049987610 9:966598-966620 GGGGGCCTTCTGAAAGAATGTGG + Intronic
1053472331 9:38355708-38355730 AGGGGCCTTCTGGGAGGCTGGGG + Intergenic
1055999054 9:82194631-82194653 GGGGGCATTCAGAGAGGAGTCGG + Intergenic
1056771558 9:89481328-89481350 GGGCCCCTTCTCAGAGGAGAGGG + Intronic
1057030302 9:91769960-91769982 GGGGGGTTTCTGGGAGGATGTGG - Intronic
1058824078 9:108759347-108759369 TGGGGGCTCCTGAGGGGATAGGG - Intergenic
1060533413 9:124363290-124363312 GGGGGCCTGCTGACAGGCTAAGG + Intronic
1061103325 9:128509559-128509581 AGGGGTCTTCTGAGAGGAAATGG - Intronic
1061512148 9:131067969-131067991 GGGAGCCTCCAGAGATGATACGG - Intronic
1061952759 9:133945536-133945558 GGGGGCATCCTGAGAGGAACCGG - Intronic
1062504347 9:136865727-136865749 GGGGGCCTTGTGTGAGGATAGGG - Intronic
1186003366 X:5039980-5040002 GGGAACCTTCTGAGCGGATGTGG - Intergenic
1187572428 X:20518716-20518738 GGGGGCATTCTGGGAAGAAACGG - Intergenic
1191668938 X:63731209-63731231 GGGGGCCTTCTGAGAGGATACGG - Intronic
1196785616 X:119419165-119419187 GCAGGCCTTCTGAAAGGATCAGG + Intronic
1198255422 X:134920132-134920154 AGGGGCCTTATGAGAGGAGTGGG + Intergenic
1200007786 X:153099236-153099258 AGGGGGCTTCTGAGATGATGGGG + Intergenic