ID: 1191669781

View in Genome Browser
Species Human (GRCh38)
Location X:63738545-63738567
Sequence ATGCGGTGCTTCAGGAAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191669781 Original CRISPR ATGCGGTGCTTCAGGAAAAA TGG (reversed) Intronic
901231410 1:7643500-7643522 ATGGGCAGCTCCAGGAAAAATGG - Intronic
901950062 1:12737516-12737538 AAAGGGTTCTTCAGGAAAAAGGG + Intergenic
902739842 1:18429806-18429828 TTGCAGGGCCTCAGGAAAAACGG - Intergenic
903799708 1:25957571-25957593 AAGTGGTGCTCCAGAAAAAAAGG + Intergenic
904482374 1:30802014-30802036 ATGCGGAGCTTTATGAAAATCGG - Intergenic
905450006 1:38050110-38050132 AGGTGGTGCTGCAGGACAAAGGG - Intergenic
908903557 1:68983088-68983110 ATGCCTTGCTTTAGGAGAAAGGG + Intergenic
909709765 1:78634485-78634507 AAGCTGTGCTTCAGAAATAAAGG + Intronic
909843909 1:80365940-80365962 AAACAGTGCTTCAGAAAAAATGG + Intergenic
909905895 1:81194205-81194227 ATGGGTTGATTGAGGAAAAAAGG - Intergenic
910535749 1:88295652-88295674 ATGATCTGCTTCAGGAAAGAAGG - Intergenic
912075232 1:105866227-105866249 ATGACCTGCTTCAGGAAAGAAGG - Intergenic
916897602 1:169181824-169181846 ATGGAGGGCTTCAGGAATAATGG - Intronic
917186107 1:172357911-172357933 ATGCATGGCTTCAGGAAAAGTGG + Intronic
917256169 1:173118698-173118720 ATGACCTGCTTCAGGGAAAAGGG + Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
920691947 1:208153948-208153970 ATGAGCTGCTTCATGAAAACAGG + Intronic
921019205 1:211221056-211221078 CTGCAGTGATCCAGGAAAAAAGG - Intergenic
921372732 1:214441504-214441526 ATGCTGATATTCAGGAAAAAAGG + Intronic
922504144 1:226116728-226116750 CTGAGGTGCTGCAGGGAAAATGG + Intergenic
923813697 1:237349426-237349448 ATGGGGTTCTTCAGGCAGAAAGG + Intronic
1064262482 10:13797239-13797261 TTTCAGTCCTTCAGGAAAAAAGG - Intronic
1064468138 10:15606125-15606147 ATGCAGTGTTTCAGGAAACATGG + Intronic
1065174286 10:23061936-23061958 ATGCCCTGCTTCAGGCAAGAAGG + Intergenic
1067797227 10:49329400-49329422 ATTCTGTGCTTCAGGAAGACAGG - Intergenic
1067817629 10:49494526-49494548 ATCTGATTCTTCAGGAAAAAGGG - Intronic
1069910089 10:71753689-71753711 ATGGGGTGCTGCATGAAAGAGGG - Intronic
1072402063 10:95113513-95113535 AAGCAGTGCTGCAGCAAAAATGG + Intergenic
1073821649 10:107271253-107271275 TTGCTGAGCTTCAGGTAAAATGG + Intergenic
1075318444 10:121470411-121470433 ATGCGGTTCTTCCGGAAGGAAGG - Intergenic
1076611190 10:131726900-131726922 ATGGGAAACTTCAGGAAAAATGG - Intergenic
1077165538 11:1134057-1134079 ATGCTGTGCCCCAGGAACAAGGG + Intergenic
1080610188 11:33897349-33897371 ATGGGTTGATTCAGGAGAAATGG + Intergenic
1081948519 11:47021296-47021318 TAAAGGTGCTTCAGGAAAAATGG - Intronic
1084608918 11:70188426-70188448 GTGCGATGCTTCAGGGAAAATGG + Exonic
1086065476 11:82739121-82739143 ATGTGGAGCTTCAGGAATACTGG + Intergenic
1088674137 11:112175296-112175318 ATGCTGTGCATCAGGATAAACGG + Intronic
1089166197 11:116478391-116478413 ATGCGGAGCTTCAGGCAGAGGGG - Intergenic
1093380367 12:18483979-18484001 ATGCTGTTCTCCAGGAAGAAAGG + Intronic
1093475284 12:19547852-19547874 TTCTGTTGCTTCAGGAAAAAAGG - Intronic
1098921298 12:76304571-76304593 ATGCTGTTCTTCTGGAAGAAAGG - Intergenic
1099323596 12:81182291-81182313 ATGCTGTCCTTCAGGAAAGAAGG + Intronic
1099430141 12:82573499-82573521 ATGCGGTCCTACATGAAAGAAGG - Intergenic
1099646700 12:85366722-85366744 ATCCTGTGCTTCGGGGAAAAAGG - Intergenic
1099938057 12:89151671-89151693 TTGCTGTGCGTCAGGAAACAGGG - Intergenic
1100717037 12:97316840-97316862 ATGACCTGCTTCAGGAAGAAGGG - Intergenic
1101523726 12:105508172-105508194 GTGGTGAGCTTCAGGAAAAACGG - Intergenic
1102622091 12:114204203-114204225 ATGAGGAGCTTCATGAGAAAAGG + Intergenic
1106845672 13:33735653-33735675 ATGACCTGCTTCAGGAAGAAGGG - Intergenic
1107712861 13:43167960-43167982 ATGACCTGCTTCAGGAAAGAAGG + Intergenic
1109254695 13:60064923-60064945 TTGCTGTGCTTCAGGGAATAGGG + Intronic
1115860778 14:37683887-37683909 ATGCTGTGGTTCAAGGAAAAGGG - Intronic
1117416636 14:55502455-55502477 ATGGCCTGCTTCAGGCAAAAAGG + Intergenic
1118022519 14:61732988-61733010 ATGCAGTGCATAAGGATAAATGG + Intronic
1118520214 14:66575167-66575189 AAGCTGTCCTTCAGGAATAAAGG - Intronic
1118616422 14:67577325-67577347 ATGCTGTGCTACAGCAAAGACGG + Exonic
1122914813 14:104853950-104853972 CTGCGGTTCATCAGGGAAAATGG - Intergenic
1125333166 15:38602023-38602045 ATGAACTGCTTCAGGGAAAAAGG - Intergenic
1126351796 15:47751739-47751761 ATGTGGTGATTCAGGACACATGG + Intronic
1128485830 15:68086914-68086936 AAGCTGTCTTTCAGGAAAAAAGG + Intronic
1129996005 15:80006821-80006843 CTGCTGTGCTCCAGGACAAATGG - Intergenic
1130761279 15:86822674-86822696 ATGCAGTTTTTCAGGAAAGAAGG + Intronic
1133694481 16:8248679-8248701 ATTAGAGGCTTCAGGAAAAAAGG + Intergenic
1135755870 16:25097568-25097590 ATGCGATGTGCCAGGAAAAATGG - Intergenic
1135869420 16:26135884-26135906 ATGCGCTGCATCTGGAAAACTGG + Exonic
1137968796 16:52962894-52962916 ATCATGTGCTTCAGGAAAAAGGG - Intergenic
1139426595 16:66884243-66884265 ATGTGTTCCTTCAGCAAAAAAGG - Exonic
1141111440 16:81274019-81274041 CTGCGGTGCTTCTGGAGCAAGGG - Intronic
1149032524 17:52100172-52100194 ATGTGATGATTCAGGAATAAAGG + Intronic
1151209586 17:72534363-72534385 AGGCTGTGCTTCAGGAAATTAGG - Intergenic
1155136196 18:22995145-22995167 TGACTGTGCTTCAGGAAAAAGGG - Intronic
1155332909 18:24736241-24736263 ATGCTGAGCTTCAGCAAGAATGG - Intergenic
1156377645 18:36529194-36529216 TTGTGGTGGTTCAGGAAATATGG + Intronic
1158348240 18:56537650-56537672 ATGCTGGGCTTAAGAAAAAAGGG + Intergenic
1158610959 18:58940449-58940471 AAGCGGTTCTTTAGCAAAAAGGG + Intronic
1164109836 19:22145799-22145821 GTGTTGTGATTCAGGAAAAAAGG + Intergenic
931450658 2:62365141-62365163 ATGCGGTGCTTCAGGACCAGTGG + Intergenic
938743051 2:134251106-134251128 ATGAGGTGCTACATCAAAAAAGG - Intronic
940773273 2:157860616-157860638 ATAAGGTGCTTCACCAAAAAAGG - Intronic
942146731 2:173034422-173034444 AGACGGGGCTTCAGGAAAAGGGG + Intronic
942615098 2:177783531-177783553 TTGCAGGGCCTCAGGAAAAAAGG - Intronic
943341431 2:186686598-186686620 TTGCTATGCTTCAGGAAAATGGG - Intergenic
944961682 2:204882050-204882072 ATCCCTTGCTACAGGAAAAAAGG - Intronic
945448133 2:209962221-209962243 ATGGCTGGCTTCAGGAAAAAAGG + Intronic
1170616665 20:17958440-17958462 ATACAGTGCTTAAGGAAAAAGGG - Intronic
1172053107 20:32134388-32134410 ATGAATTGCTTGAGGAAAAATGG - Intronic
1172811435 20:37650969-37650991 ATGCTGTGCTCCAGAAAAAATGG + Intergenic
1173527208 20:43742365-43742387 AAGCGGTGAGTTAGGAAAAAAGG + Intergenic
949355646 3:3178143-3178165 ATCCGGTGTTTCAGGGAGAATGG - Intronic
949839095 3:8301056-8301078 GTGCAGTGTATCAGGAAAAATGG - Intergenic
951593215 3:24289058-24289080 ATGAGGAGCCTCATGAAAAATGG + Intronic
959762474 3:109982856-109982878 ATGCTGTGCTATAGAAAAAAGGG - Intergenic
960507663 3:118513106-118513128 ATGGCCTGTTTCAGGAAAAAAGG - Intergenic
963134603 3:141889902-141889924 ATCCAGTGCTTGAGGAGAAAAGG - Intronic
963181001 3:142355952-142355974 ATGCTGAGCTTTAGAAAAAAAGG - Intronic
964670065 3:159215156-159215178 ATGCTGGGCTTGATGAAAAATGG + Intronic
966080303 3:175992074-175992096 ATGATCTGCTTCAGGGAAAAAGG + Intergenic
967656883 3:192061057-192061079 ATGGGGTGATTCAGGAAATATGG + Intergenic
967966379 3:194963413-194963435 ATTTGGTTCTTCAGTAAAAAAGG - Intergenic
968130986 3:196192682-196192704 AAGCTGTGGTTCAGGAAAAGTGG + Intergenic
969154665 4:5200008-5200030 ATGAGGTGCTGTAGGAACAAAGG + Intronic
971155134 4:24073886-24073908 ATGTGGTGGTGCAGGAAAGAGGG + Intergenic
971415512 4:26424343-26424365 ATGCATTGCCTCAGGAACAAAGG + Exonic
971756949 4:30718816-30718838 AAGCCTTGCTTCAGGAAATAGGG + Intergenic
974602589 4:64104818-64104840 TTATGTTGCTTCAGGAAAAAGGG - Intergenic
976688496 4:87842732-87842754 AGGTGTTGCATCAGGAAAAATGG + Intronic
977103734 4:92852707-92852729 ACGAGGAGCTACAGGAAAAATGG - Intronic
980198863 4:129627540-129627562 ATGAGCTGCTTCAGGAGAAAAGG - Intergenic
980806396 4:137820191-137820213 ATGCCATGTTTCAGGAAGAATGG - Intergenic
981403251 4:144338882-144338904 ATGGCCTGCTTCAGGAGAAAGGG - Intergenic
982791123 4:159592643-159592665 ATGATCTGCTTCAGGGAAAAAGG + Intergenic
986452237 5:7878127-7878149 ATTCGATGATTCAGGAAGAAAGG + Exonic
992146273 5:73852708-73852730 ATGCAGTTCCTCAGGAAAATTGG - Intronic
993748754 5:91638514-91638536 GAGCAGTGTTTCAGGAAAAAAGG + Intergenic
994994239 5:107039239-107039261 ATGACGTGCTTCAGGAAAGAAGG + Intergenic
995380422 5:111525597-111525619 ATGCGGCGCTGCAGGAGACAAGG + Intergenic
995599850 5:113783425-113783447 TTGAGGGGCTTCAGGAAAGATGG + Intergenic
996090594 5:119347711-119347733 AAACAGGGCTTCAGGAAAAATGG - Intronic
996857583 5:128027059-128027081 ATGTGGTCCTACAGGGAAAATGG + Intergenic
997031705 5:130137447-130137469 ATATAGTGCTTCAGGGAAAAAGG - Intronic
1001011831 5:168105688-168105710 ATCCAGGGCCTCAGGAAAAATGG + Intronic
1003024053 6:2537711-2537733 ATGACGTGCTTCACGAAGAAGGG + Intergenic
1003556977 6:7148656-7148678 ATGCTATGCTTAAGGAAACAGGG + Intronic
1005075770 6:21905393-21905415 ATCAGGTGCTTTAGGTAAAAGGG - Intergenic
1005316014 6:24603601-24603623 CTGCAGTGCTTCTGGAAACAGGG - Intronic
1006822377 6:36907773-36907795 GTCTGGTGCTTCAGGAAAAGTGG + Intronic
1007822520 6:44571114-44571136 ATAAGATGCTTCATGAAAAAGGG + Intergenic
1009868633 6:69429445-69429467 ATGTGGTTCTTTAGAAAAAAGGG + Intergenic
1012168989 6:95994843-95994865 ATTCTGTCCTTCATGAAAAATGG - Intergenic
1013922359 6:115422089-115422111 ATGAAGTGCTTCAGGTGAAAAGG - Intergenic
1016187468 6:141214554-141214576 ATGAGCTGCTTCAGAAAATATGG - Intergenic
1017049226 6:150374896-150374918 ATGACCTGCTTCAGGAAAGAAGG + Intronic
1017998709 6:159558632-159558654 AGGATGTACTTCAGGAAAAAGGG + Intergenic
1022590919 7:31661891-31661913 ATGCGATTGCTCAGGAAAAATGG - Intergenic
1023100314 7:36711381-36711403 ATGCTGTGCTTCAGGAACAAAGG - Intronic
1030971517 7:116063282-116063304 ATGCAAAGGTTCAGGAAAAAAGG + Intronic
1031055460 7:116988193-116988215 ATGGGCTGATTCAGGAAAATAGG - Intronic
1034732934 7:153403635-153403657 TTTCGGTGCTTGAGAAAAAAAGG + Intergenic
1037314221 8:17585526-17585548 GTGGGGTGTTTCATGAAAAATGG + Intronic
1042208779 8:66356299-66356321 ATGACCTGCTTCAGGAAAGAAGG - Intergenic
1042700958 8:71613886-71613908 TTGTGGTGTTTCAGGAAGAAGGG - Intergenic
1044929083 8:97234672-97234694 ATGAGCTGCATCTGGAAAAAGGG - Intergenic
1045577849 8:103445220-103445242 TTGTGGTCCTTCAGGGAAAAGGG - Intergenic
1046575624 8:116025226-116025248 TTGCAGTGCTTTAGGAGAAATGG - Intergenic
1051076708 9:13247370-13247392 ATGAGTTTCTACAGGAAAAACGG - Intronic
1053198500 9:36137263-36137285 ATGGGGTGCCCCAGGAGAAAGGG - Intronic
1053613559 9:39740688-39740710 ATGCATTGCCTCAGGAAAAAAGG - Intergenic
1053871600 9:42498645-42498667 ATGCATTGCCTCAGGAAAAAAGG - Intergenic
1054239955 9:62601709-62601731 ATGCATTGCCTCAGGAAAAAAGG + Intergenic
1054450981 9:65403593-65403615 ATGTGTGGCTTCAGGACAAAGGG + Intergenic
1054554088 9:66636235-66636257 ATGCATTGCCTCAGGAAGAAAGG + Intergenic
1055113167 9:72579552-72579574 AAGAGGGGCTCCAGGAAAAAGGG - Intronic
1057486205 9:95486560-95486582 CTGGGGTGCTTCCGGAAAACAGG - Intronic
1058198109 9:102003579-102003601 ATGCATTGCTCCAGGAAAATAGG - Intergenic
1059195506 9:112367480-112367502 ATGCTGTCCTTCAGAAATAAAGG - Intergenic
1060470714 9:123945874-123945896 ATGGCCTGCTTCAGGGAAAAGGG + Intergenic
1187715048 X:22094402-22094424 ATGAGTTTCTCCAGGAAAAACGG - Intronic
1187869608 X:23753685-23753707 ATGGGGAGCTTCTGGAAAAAGGG - Intronic
1191669781 X:63738545-63738567 ATGCGGTGCTTCAGGAAAAATGG - Intronic
1199676749 X:150195882-150195904 ATCTGTTGCTTCAGGAAGAAGGG + Intergenic