ID: 1191670577

View in Genome Browser
Species Human (GRCh38)
Location X:63745018-63745040
Sequence CACAATTCACAGAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 293}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191670563_1191670577 20 Left 1191670563 X:63744975-63744997 CCCAATGCCAAGGCACCTACTCC 0: 1
1: 0
2: 2
3: 14
4: 120
Right 1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 30
4: 293
1191670569_1191670577 -3 Left 1191670569 X:63744998-63745020 CCAGCCTTCTTGCCATCCTGCAC 0: 1
1: 0
2: 4
3: 31
4: 516
Right 1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 30
4: 293
1191670567_1191670577 -1 Left 1191670567 X:63744996-63745018 CCCCAGCCTTCTTGCCATCCTGC 0: 1
1: 0
2: 6
3: 61
4: 715
Right 1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 30
4: 293
1191670562_1191670577 27 Left 1191670562 X:63744968-63744990 CCTCTATCCCAATGCCAAGGCAC 0: 1
1: 0
2: 0
3: 9
4: 117
Right 1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 30
4: 293
1191670568_1191670577 -2 Left 1191670568 X:63744997-63745019 CCCAGCCTTCTTGCCATCCTGCA 0: 1
1: 0
2: 3
3: 50
4: 583
Right 1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 30
4: 293
1191670564_1191670577 19 Left 1191670564 X:63744976-63744998 CCAATGCCAAGGCACCTACTCCC 0: 1
1: 0
2: 0
3: 16
4: 149
Right 1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 30
4: 293
1191670566_1191670577 5 Left 1191670566 X:63744990-63745012 CCTACTCCCCAGCCTTCTTGCCA 0: 1
1: 0
2: 2
3: 59
4: 557
Right 1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 30
4: 293
1191670565_1191670577 13 Left 1191670565 X:63744982-63745004 CCAAGGCACCTACTCCCCAGCCT 0: 1
1: 0
2: 3
3: 40
4: 423
Right 1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 30
4: 293
1191670570_1191670577 -7 Left 1191670570 X:63745002-63745024 CCTTCTTGCCATCCTGCACAATT 0: 1
1: 0
2: 1
3: 24
4: 253
Right 1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG 0: 1
1: 0
2: 1
3: 30
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191670577 Original CRISPR CACAATTCACAGAGGGAGGA GGG Intronic
900693640 1:3996670-3996692 CACAAGCCTCAGAGGGAGTACGG - Intergenic
900694126 1:3999715-3999737 GACATGTCACAGAGGGAGGAAGG + Intergenic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902689938 1:18104805-18104827 CACCATGAACAGAGGGAGGCTGG + Intergenic
903292919 1:22326074-22326096 GAAGATTCACAGAGGGAGGGAGG - Intergenic
904438693 1:30515867-30515889 CACAAAGCACTGAGGGAGGTGGG - Intergenic
908224131 1:62039151-62039173 GACAATTAACAAAGGTAGGATGG - Intronic
908859143 1:68463724-68463746 CTGATTTAACAGAGGGAGGAGGG - Intergenic
911224547 1:95290899-95290921 GAGAAGTAACAGAGGGAGGACGG - Intergenic
913523812 1:119671113-119671135 CACAGGTCCTAGAGGGAGGAGGG + Intronic
915098892 1:153484495-153484517 CCTAATTCCCAGAGTGAGGAGGG - Intergenic
916033714 1:160902150-160902172 CACAATTCACTGAAGGAGAAAGG - Intergenic
916545488 1:165800304-165800326 CACAATTAACAGAGTGAAAAAGG + Intronic
918215172 1:182387082-182387104 CAGCATTCACAGATTGAGGAGGG + Intronic
919051085 1:192512399-192512421 CACAAATTAGAGATGGAGGAAGG - Intergenic
920043208 1:203117210-203117232 TACAATTCCCACAGTGAGGAGGG - Intronic
920854652 1:209652711-209652733 CAGAATTCACAGGGTGGGGAAGG + Intergenic
922472359 1:225884088-225884110 CACCATTCATTGAGGAAGGAAGG - Intergenic
922610525 1:226923781-226923803 CACAGTCCAAAGAGGGAGCAGGG + Intronic
922662599 1:227443194-227443216 GACATTTCATGGAGGGAGGACGG + Intergenic
1062984225 10:1752488-1752510 CACCATCCACACAGGAAGGATGG + Intergenic
1063953437 10:11244892-11244914 CACCAGACACAGATGGAGGAAGG - Intronic
1065030292 10:21579240-21579262 CACATTACACAGAGGGCAGAGGG - Intronic
1066748354 10:38626141-38626163 CACCATTCAGAAAGGGAGGAGGG - Intergenic
1066968324 10:42291634-42291656 CACCACTCAGAAAGGGAGGAGGG + Intergenic
1067356434 10:45532550-45532572 CACATGGCATAGAGGGAGGAAGG - Intronic
1067668453 10:48298983-48299005 CAAAATTTACACAGGGAGCAAGG - Intergenic
1067766883 10:49093599-49093621 CACATTCCATAGAGAGAGGAAGG - Intronic
1068372599 10:56137409-56137431 CAGAAATCACACAGTGAGGAAGG - Intergenic
1069635174 10:69920600-69920622 CACAAGGCAGAGAGGGAGAACGG - Intronic
1070597806 10:77844952-77844974 CCCAATGCACAGGGGGAGGTGGG + Intronic
1070625207 10:78046175-78046197 CAGAATTCTCAGAGGCAGAACGG - Intronic
1071746636 10:88427144-88427166 CACAATTCACACAGTTAGCAAGG + Intronic
1071820904 10:89279704-89279726 CAGAATTGACAGTGGAAGGAGGG + Intronic
1073440119 10:103547567-103547589 CAGAATCCCCAGAGGAAGGAGGG + Intronic
1074695063 10:116043019-116043041 CACAATTCACATAGATAAGAGGG + Intergenic
1074718188 10:116240003-116240025 AGCAATTCACAGAGGGAGAAAGG + Intronic
1075369343 10:121921772-121921794 CACAGTTCACAGAAGGGGGTGGG - Intronic
1076023233 10:127091447-127091469 CACAATTCAAAAAGGAAAGAGGG - Intronic
1077194113 11:1270736-1270758 CGCCATTCACTGAGGGTGGAGGG + Intergenic
1077702376 11:4454287-4454309 CACAATTTGCAAAGGGAGGAGGG - Intergenic
1080570505 11:33552232-33552254 GACAATTCAGGTAGGGAGGAAGG + Exonic
1080688716 11:34537725-34537747 CAGAGGTCACAGAGGGAAGACGG - Intergenic
1081088788 11:38835505-38835527 CAGAATTCACACAGGTAGAAGGG + Intergenic
1081650861 11:44823301-44823323 GACAATTCAAAGGGTGAGGATGG + Intronic
1081792423 11:45797688-45797710 CCCAATTCACAGAGGTATCATGG + Intergenic
1083535546 11:63463802-63463824 CAAATGGCACAGAGGGAGGAAGG - Intronic
1084970625 11:72769850-72769872 CGCACATCACAGAGGGTGGAGGG + Intronic
1085303027 11:75469395-75469417 ACCAAGTCACAGAGGAAGGAAGG + Intronic
1085976499 11:81661465-81661487 CACAATGCACAGATGGGGCATGG - Intergenic
1087341627 11:96914436-96914458 AATAAGTCACAGAGGGAGGGAGG - Intergenic
1087694570 11:101361887-101361909 CACAATCCACTGAGGGAGTGGGG - Intergenic
1088339984 11:108753520-108753542 CACGATGGACAGAGGGAGAACGG - Intronic
1089219051 11:116855515-116855537 CACAAGTCACACAGGAAGGAAGG + Intronic
1089639871 11:119840696-119840718 AACAATCCAGAGAGGGAAGAAGG + Intergenic
1089768180 11:120783686-120783708 CAAAATGCATAGAGGGACGAGGG - Intronic
1090150015 11:124374240-124374262 GACAATTCAAAGGGTGAGGATGG + Intergenic
1090169267 11:124584465-124584487 CTCAATTCTCAGAGTGTGGAGGG - Intergenic
1091069169 11:132547193-132547215 CACTTTTCAAAGAGGGAAGAAGG - Intronic
1091448944 12:560914-560936 CACACGTCATAGACGGAGGAAGG - Intronic
1095332001 12:40977369-40977391 AATAATTCCCAAAGGGAGGAGGG + Intronic
1095530792 12:43184030-43184052 GACAATTCACAGAGTGGGAATGG + Intergenic
1095878737 12:47109265-47109287 CTCCATTTACAGAGAGAGGAAGG - Intronic
1096536079 12:52275691-52275713 CCCATTTCACAGATGGAGAAAGG + Intronic
1096780561 12:53989492-53989514 CACCAGGCACAAAGGGAGGAGGG - Exonic
1096896958 12:54830665-54830687 CAGAATGAACAGAGGGATGAAGG - Intronic
1098150034 12:67537385-67537407 CACGAGTCACAGAGTTAGGAGGG - Intergenic
1099050974 12:77781291-77781313 CAGAATTCCAAAAGGGAGGAGGG - Intergenic
1099551143 12:84044462-84044484 GAGAATTCACAAAGAGAGGATGG - Intergenic
1099679072 12:85801438-85801460 CTCAATTCAAAAAGGGAGCAGGG + Exonic
1101950627 12:109171985-109172007 CACAGTTCACAAGGGGTGGAGGG + Intronic
1102200163 12:111052326-111052348 GACAATCCACAGAGGGAGGCCGG - Intronic
1102448128 12:113019351-113019373 CACATTTTACAGAGGGGGAAAGG + Intergenic
1102780746 12:115562424-115562446 CACAAATAGCAGAGGGAAGAGGG - Intergenic
1104709535 12:130975939-130975961 AAACATTCACAGAGGGAGGAAGG - Intronic
1104925356 12:132311228-132311250 GACATTTCAAAGAGGGAGAAAGG + Intronic
1107440478 13:40422980-40423002 CAGACTCCCCAGAGGGAGGAGGG - Intergenic
1108554381 13:51578721-51578743 CACAATTTAAAGAAGGAGGAAGG + Intergenic
1108558776 13:51622729-51622751 CACAATTCAGTCAGGGAGGTAGG + Intronic
1109636418 13:65123714-65123736 CAGAATACACACAGGGAAGAAGG + Intergenic
1110738410 13:78965584-78965606 TACAACTCACAGAGTGAGGATGG - Intergenic
1112002126 13:95220668-95220690 AAAAATGCACAGAGAGAGGAGGG + Intronic
1113238311 13:108307257-108307279 CACAATTCAAAGGGGCAGTAAGG + Exonic
1113459915 13:110474501-110474523 CACAGTTCACTGAGAGAGCAAGG + Intronic
1113576080 13:111396214-111396236 CAGCATGCACCGAGGGAGGAGGG + Intergenic
1114465368 14:22918602-22918624 CACCATTCAGAGAGAGAGAAGGG - Intronic
1115375500 14:32671028-32671050 TTCAATTCACTGAGGGAAGATGG + Intronic
1116030791 14:39568755-39568777 CACATTTTGCAGAGGGAGAAGGG + Intergenic
1116566352 14:46449096-46449118 GACAGTTCAAAGAGCGAGGAGGG - Intergenic
1116576368 14:46581314-46581336 CAAAATGCACAAAGGAAGGAAGG + Intergenic
1117255449 14:53972619-53972641 GACAATAAAGAGAGGGAGGAAGG + Intergenic
1118008413 14:61586066-61586088 CAGAAGGCAGAGAGGGAGGAAGG - Intronic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1122640939 14:103158896-103158918 CAGAACTCACAAAGGGAGGAGGG - Intergenic
1122659728 14:103287332-103287354 CACACAGCACAGAGTGAGGATGG - Intergenic
1123176461 14:106423436-106423458 CATAATTCTGAGAGTGAGGAAGG - Intergenic
1124154295 15:27211739-27211761 CACAATTCTAGGTGGGAGGATGG - Intronic
1124653981 15:31493970-31493992 CTCAAAGCAGAGAGGGAGGAGGG + Intronic
1127469341 15:59276401-59276423 CACACTGTACAAAGGGAGGAGGG + Intronic
1127845470 15:62866621-62866643 CCAAATTCACACAGGGAGGAAGG - Intergenic
1129147512 15:73662271-73662293 CAAAATTAACAGATGAAGGATGG - Intergenic
1132056296 15:98651866-98651888 CACATTTCAGAGATGGAGGGAGG - Intronic
1133471197 16:6077492-6077514 CACAATTCCAAGAGGGATGGTGG - Intronic
1133518648 16:6534718-6534740 CAGAATGCAAAGAGGGAGAAGGG + Intronic
1133777298 16:8907028-8907050 CAAAATTAACAGAGGCAGGAAGG + Intronic
1135201195 16:20439069-20439091 CATACTTCCCACAGGGAGGAAGG - Intronic
1135217913 16:20588795-20588817 CATACTTCCCACAGGGAGGAAGG + Intergenic
1135959479 16:26983793-26983815 CCCAAAGCACAGAGGCAGGAAGG - Intergenic
1138459504 16:57139825-57139847 CCCAAGTCACACAGTGAGGAAGG - Intronic
1140193267 16:72836204-72836226 CGAAAGTCACAGAGGGAGAATGG - Intronic
1141260730 16:82451447-82451469 CACAGTTCAGGGAGGTAGGAGGG + Intergenic
1141797632 16:86285813-86285835 CACAATTGACCTTGGGAGGAAGG - Intergenic
1142623020 17:1176967-1176989 AACAATGCTCAGAGAGAGGAAGG + Intronic
1143254850 17:5548390-5548412 CTCTATCCTCAGAGGGAGGAGGG - Intronic
1143325101 17:6093480-6093502 CACAATCCAGAGATGGGGGAGGG - Intronic
1144415558 17:15042876-15042898 CAGATTTTTCAGAGGGAGGAAGG + Intergenic
1146945239 17:36869158-36869180 CAGAGGTCACAGAGGGAGGAGGG + Intergenic
1149729025 17:58925992-58926014 CACAATTCCCAGTTGGAGGAGGG - Intronic
1151923483 17:77175351-77175373 CACACTTCACAGAAGGGGGTGGG + Intronic
1152736520 17:82000008-82000030 CAGAGTTCCCAGAGGGAGGATGG - Intronic
1153605703 18:6829106-6829128 TACATTTCACTGATGGAGGATGG - Intronic
1154342333 18:13514216-13514238 CACAGTTCACAGAGAGAGTCAGG - Intronic
1154380794 18:13848362-13848384 CACAATTGAGGGAGTGAGGAGGG - Intergenic
1155239451 18:23851620-23851642 GACAAACCATAGAGGGAGGAAGG - Intronic
1155340854 18:24812695-24812717 CCCAACTCACAGAGAGAAGAGGG - Intergenic
1157257813 18:46154037-46154059 GAGAATTCAAAGATGGAGGAAGG + Intergenic
1157511174 18:48275987-48276009 CTCAAGATACAGAGGGAGGAGGG + Intronic
1157948362 18:52006480-52006502 CACAGTTGACAGAGGTAAGATGG - Intergenic
1159016984 18:63109264-63109286 CAGAATTCACAGAGGGTGGGAGG + Intergenic
1159794214 18:72822228-72822250 CTCAAGTCTCAGAGGGTGGAGGG + Intronic
1160070421 18:75623272-75623294 CAAAAATCATAGAGTGAGGAGGG + Intergenic
1160132144 18:76235012-76235034 GACCATTCACAGAGGAAGGGGGG - Intergenic
1160794227 19:936929-936951 GCCAATCCACAGAGGCAGGAGGG - Intronic
1160855099 19:1213694-1213716 CACAATTCACAGGCAGAGGCGGG - Intronic
1160897796 19:1410862-1410884 GGAAAGTCACAGAGGGAGGAAGG + Intronic
1161070755 19:2259352-2259374 GCCAATTCACAGAGACAGGAAGG + Intronic
1161171871 19:2816184-2816206 CACAAGTCCCATGGGGAGGATGG - Intergenic
1161237499 19:3205135-3205157 CACAGTGCCCAGAGGGAGGCGGG - Intronic
1161308435 19:3579821-3579843 GTCAATCCACAGAGGCAGGAAGG - Intergenic
1161361700 19:3853627-3853649 GCCAATCCACAGAGGCAGGAAGG + Intronic
1161533384 19:4803897-4803919 TGCAATTTACAGAGGGACGAGGG + Intergenic
1162527265 19:11213529-11213551 CACAGTTTACAGTGGAAGGAAGG - Intronic
1162641616 19:12014639-12014661 GAGAAGTCACAGAGGGAGAATGG - Intergenic
1163242708 19:16074186-16074208 AGCAAGTCAGAGAGGGAGGAAGG + Intronic
1164411818 19:28012551-28012573 TACAATGCACAGAGGGAGCGGGG - Intergenic
1164516837 19:28943862-28943884 TACAATGCACAGAGGGAGCAGGG - Intergenic
1164613616 19:29650907-29650929 CTGAATTCCAAGAGGGAGGAGGG + Intergenic
1165813749 19:38628369-38628391 GGAAACTCACAGAGGGAGGAGGG - Intronic
1166248296 19:41546574-41546596 AAGAAATCATAGAGGGAGGAGGG - Intergenic
1166803746 19:45472996-45473018 AAGAGTTCACAGAGCGAGGAGGG - Exonic
1168008344 19:53509219-53509241 CGCAGCTCACAGAGGAAGGAGGG - Intergenic
925658840 2:6181260-6181282 CACAATCCAAGCAGGGAGGAAGG + Intergenic
926081454 2:9989889-9989911 CAGAATTCACAAAGTGAAGATGG - Intronic
926776988 2:16432564-16432586 CACATGGCACAGAGGAAGGATGG + Intergenic
926798649 2:16639834-16639856 GATAAGTCAGAGAGGGAGGAGGG + Intronic
926888404 2:17618355-17618377 CAGAATTTAAAGATGGAGGAGGG - Intronic
927018464 2:18993254-18993276 AACGATTCACAGAGGGTGAATGG - Intergenic
928697061 2:33859994-33860016 CACAATACACAGCCGCAGGAGGG - Intergenic
930580836 2:53209907-53209929 GACAGTTCACAGAGGGAGCCAGG - Intergenic
931195347 2:60047488-60047510 CCCAATTCTCAGAGGCAGGGAGG + Intergenic
931443187 2:62305622-62305644 GACAATTCACAGAGGCCAGACGG + Intergenic
931989480 2:67775816-67775838 CCCAATTCACAGAGACAGTAAGG + Intergenic
932353482 2:71050020-71050042 GACAAGTGACAGAGGAAGGATGG + Intergenic
934043062 2:88146144-88146166 CACAAGTAACACAGGTAGGAAGG + Intergenic
934311327 2:91868289-91868311 CACCATTCAGAAGGGGAGGAGGG - Intergenic
935300895 2:101693213-101693235 CTCCATTGACAGAGGGAGGGAGG - Intergenic
935691809 2:105739067-105739089 CACAATTCTTAGAGAGAGGCAGG + Intergenic
935704727 2:105846106-105846128 CACTAATCACACTGGGAGGAAGG - Intronic
936540113 2:113342825-113342847 CACATTACAAAGAGGAAGGACGG - Intergenic
937249945 2:120517279-120517301 CCCATTTCACAGATGGGGGAAGG + Intergenic
938220619 2:129563608-129563630 CACAAGCCACAGAGTGGGGAAGG - Intergenic
938928635 2:136066747-136066769 CAAGATTCACAGATGGAGGATGG + Intergenic
941618843 2:167754527-167754549 CAGATTTCACAGAAAGAGGAAGG + Intergenic
941984161 2:171492838-171492860 TACAATTCACAGAGGAAGTGGGG + Intergenic
944931496 2:204524862-204524884 CATAATTCACATAGAGAAGAAGG - Intergenic
947162349 2:227227262-227227284 CACAAGGCACTGGGGGAGGAGGG - Intronic
947441994 2:230131534-230131556 CACCATGCAGAGAGGGAGCAAGG - Intergenic
947442812 2:230138009-230138031 CAGAAGACACAGAGGGAGGTAGG - Intergenic
947833232 2:233156671-233156693 CACACCTCACTGGGGGAGGAGGG - Intronic
1169224240 20:3846513-3846535 CAAAGTTCCCAGGGGGAGGAGGG + Intergenic
1170823772 20:19776206-19776228 CTGAATTCCCAAAGGGAGGAGGG - Intergenic
1171235797 20:23523669-23523691 CAAAATGCAAAGAGGGAAGAGGG + Intergenic
1173018208 20:39245748-39245770 CAGTTTTCACAGAGGGAGGAGGG + Intergenic
1173262706 20:41451073-41451095 CCCAGTCCCCAGAGGGAGGAAGG - Exonic
1173495079 20:43513047-43513069 CTGAATCCCCAGAGGGAGGAGGG + Intronic
1174356997 20:50005351-50005373 CCCAAGTCCCAGAGGAAGGAGGG + Intergenic
1175096211 20:56543522-56543544 GACTATTCACAGAGCTAGGAGGG - Intergenic
1176984534 21:15420785-15420807 CTCAGGTCACTGAGGGAGGATGG + Intergenic
1179599324 21:42465585-42465607 CACCATTAATAGAGGGAGGCAGG - Intergenic
1179680426 21:43016933-43016955 CACAATTCCCTGAGGGCTGATGG - Exonic
1181388994 22:22565507-22565529 TTCACTGCACAGAGGGAGGAGGG - Exonic
1181469540 22:23129242-23129264 GACAATGAGCAGAGGGAGGAAGG - Intronic
1181778130 22:25174531-25174553 GGCAATTCACAGAGAGAGGCTGG - Intronic
1182129512 22:27840639-27840661 AACAATCCAGGGAGGGAGGATGG + Intergenic
1183374450 22:37454823-37454845 CGGACATCACAGAGGGAGGAAGG - Intergenic
1183411998 22:37660297-37660319 ACCAATTCCCAGAGGCAGGATGG - Intronic
1184301609 22:43564046-43564068 CCCATTTCTCAGATGGAGGACGG - Intronic
1184882119 22:47314356-47314378 CACAAAGGACAGAAGGAGGAAGG - Intergenic
1185045435 22:48526225-48526247 CACCACACACAGACGGAGGAGGG - Intronic
1185135395 22:49068737-49068759 GGGAATTCACAGAGGCAGGACGG - Intergenic
1185135408 22:49068787-49068809 GCCAATTCACAGAGCCAGGACGG - Intergenic
949151387 3:772158-772180 GACAATGCACAGTGGGAGAAAGG + Intergenic
951621587 3:24607848-24607870 CCCAATTCACTGAGAAAGGATGG - Intergenic
953192091 3:40697582-40697604 CCCATTTCACAGAAGTAGGATGG - Intergenic
954553563 3:51501653-51501675 CACATTTAAGAGAAGGAGGATGG - Intergenic
956760349 3:72437648-72437670 CTAAATTGACAGAGGGAGAAAGG + Intronic
956997279 3:74841964-74841986 AACAATTTACAGTGAGAGGATGG - Intergenic
957971025 3:87382318-87382340 CATAATTCAAAGAGGAAGAAAGG - Intergenic
959822699 3:110755499-110755521 CACAATTCAGTGTGGGAGGTGGG + Intergenic
961041229 3:123679876-123679898 CACACTTAACAGAGGCAGCAGGG + Intronic
961739625 3:129024992-129025014 CACACTTCACTGAGGGAGGGAGG + Intronic
963107178 3:141657435-141657457 GACAATTCAAAGGGTGAGGAGGG - Intergenic
963117645 3:141745497-141745519 CACACACCACAGAGGTAGGAAGG - Exonic
964372836 3:156019042-156019064 CCCTAGTCACAGAGGCAGGAAGG + Intergenic
964481435 3:157142554-157142576 CACAATTAACAGGGGGTGGAGGG + Intergenic
964530977 3:157667481-157667503 CAGAATTAAAAGATGGAGGAAGG + Intronic
965090197 3:164151609-164151631 CACATTACAGAGAGAGAGGAAGG - Intergenic
968231812 3:197008887-197008909 CACAGTGCACACAGCGAGGAGGG + Exonic
968564546 4:1304089-1304111 CACGACTGACAGGGGGAGGAGGG - Intronic
971552423 4:27974600-27974622 GTTAAATCACAGAGGGAGGAAGG - Intergenic
971992956 4:33924934-33924956 CACAAACCACAAAGGGAGGTTGG - Intergenic
972342633 4:38165747-38165769 AACAATTGACAGAGAGAGGCAGG - Intergenic
973199105 4:47479565-47479587 CAAGATTCACAGAGAAAGGAGGG + Intergenic
973792864 4:54394633-54394655 CACTGTTCAGAGAGGGAGGCAGG - Intergenic
973864829 4:55101975-55101997 CACTATCCGCAGAGTGAGGAAGG - Exonic
974258458 4:59492774-59492796 AACAATTCACAGAAGAAAGAGGG - Intergenic
975002457 4:69241315-69241337 CTGAATTCAAAAAGGGAGGAGGG + Intergenic
975007440 4:69308458-69308480 CTGAATTCAAAAAGGGAGGAGGG - Intronic
975010562 4:69345297-69345319 CTGAATTCAAAAAGGGAGGAGGG + Intronic
976993407 4:91399164-91399186 AGCAATTCTCAAAGGGAGGAAGG + Intronic
980264674 4:130500054-130500076 CCAAATTCCCAAAGGGAGGAGGG - Intergenic
981420835 4:144548432-144548454 CACAATTCAAGGAAGGAAGAAGG + Intergenic
982352689 4:154433223-154433245 CACAAGCCAAGGAGGGAGGAAGG + Intronic
983274977 4:165605782-165605804 CAGAATACAGAGAAGGAGGAAGG + Intergenic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
986602529 5:9487383-9487405 CAAAGGTCACAGAGGTAGGAAGG + Intronic
987146829 5:14999560-14999582 CTCAATTCACAGTAGCAGGATGG + Intergenic
989605711 5:43242487-43242509 CACAGTTCTCAGGGGGATGATGG + Intronic
991156348 5:63440766-63440788 CACAGATCACAGAGAGAAGAGGG - Intergenic
991403463 5:66278015-66278037 CACTATTCTCAGAGGGTAGAAGG + Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
998200143 5:140113007-140113029 CCCAAATCTCAGAAGGAGGAGGG + Intronic
998354354 5:141522383-141522405 CAGAACTCACAGGTGGAGGAAGG - Intronic
998578286 5:143341899-143341921 GAAAATACAGAGAGGGAGGAGGG + Intronic
999850693 5:155535405-155535427 CCAAATTCACATAGGTAGGAAGG - Intergenic
1000382183 5:160639070-160639092 CACAAAGCACAGAGGCAGGAAGG - Intronic
1001701466 5:173709749-173709771 CCCCATTGACAGAGGGAGAAAGG - Intergenic
1001978514 5:176021114-176021136 CACAGATCCCAGAGAGAGGAGGG + Intronic
1002238903 5:177822648-177822670 CACAGATCCCAGAGAGAGGAGGG - Intergenic
1002556605 5:180046511-180046533 GACAATTCTCAGGGGTAGGAAGG - Intronic
1004314665 6:14575402-14575424 CACATTTCACAGATGAAGAAAGG + Intergenic
1005006762 6:21295044-21295066 AACACTTCACAGAGGAGGGAGGG - Intergenic
1005061115 6:21777889-21777911 CAAACCTCACAGAGGGAGGGAGG - Intergenic
1006047204 6:31308147-31308169 GACCAATGACAGAGGGAGGAAGG - Intronic
1006150212 6:31983049-31983071 CAAACTCCACAGAGGGAGCAGGG - Intronic
1006156513 6:32015787-32015809 CAAACTCCACAGAGGGAGCAGGG - Intronic
1006389136 6:33748328-33748350 CTCATTTCACAGAGGTAAGATGG + Intergenic
1007608479 6:43132977-43132999 CCCAATGCACAGAGTGACGATGG + Intronic
1010106388 6:72174117-72174139 CTCAAATCACAGATGGAGGAGGG - Intronic
1010391885 6:75347089-75347111 TTCAATGCACAGAGGGAGAAAGG - Intronic
1012275670 6:97272549-97272571 CACAATTAATAAAAGGAGGATGG + Intronic
1012602725 6:101117622-101117644 CACAATGCAAAGTGGCAGGAAGG + Intergenic
1012988311 6:105898563-105898585 CCCAATGTACTGAGGGAGGATGG + Intergenic
1013087754 6:106870982-106871004 CCCAATTCACAGAGCTAAGAAGG - Intergenic
1013296713 6:108764311-108764333 CAAAATTCACAAGGAGAGGAAGG - Intergenic
1015167123 6:130210757-130210779 CTCAATTCTAAAAGGGAGGAGGG - Intronic
1015349767 6:132203913-132203935 CAGAAGTTAGAGAGGGAGGAAGG - Intergenic
1016907786 6:149168922-149168944 CACAGTTCCCAAGGGGAGGAGGG + Intergenic
1017307171 6:152932204-152932226 CACCATCCAGAAAGGGAGGAGGG - Intergenic
1018116976 6:160595906-160595928 CATATTTCACAGAAGGTGGAAGG - Intronic
1018330707 6:162725038-162725060 CACACTTCACAAACGGAGGTGGG - Intronic
1019773268 7:2896968-2896990 CGCAATTCAGAGAGAGAGGAGGG - Intergenic
1021083506 7:16391388-16391410 GACTAATCTCAGAGGGAGGATGG - Intronic
1022760144 7:33339910-33339932 TCCAATACACAGAGGGAGGAGGG + Intronic
1023150668 7:37198771-37198793 CACAATACACTCAGGGACGAAGG + Intronic
1023844555 7:44113459-44113481 CGAAATTCAGAGAGGGAGGGCGG + Intronic
1026918556 7:74138448-74138470 CATCATTCAAAGAGGCAGGAAGG - Intergenic
1027328477 7:77066152-77066174 TACAATTCACAGAAGCAGAAAGG - Intergenic
1027722210 7:81758447-81758469 AAAAATAAACAGAGGGAGGAAGG + Intronic
1027899519 7:84092758-84092780 CACAATTAAAGGAGGGAAGAAGG - Intronic
1029473204 7:100767407-100767429 GGTATTTCACAGAGGGAGGAGGG - Intronic
1029746787 7:102520029-102520051 TACAATTCACAGAAGCAGAAAGG + Intergenic
1029764720 7:102618989-102619011 TACAATTCACAGAAGCAGAAAGG + Intronic
1030090264 7:105852075-105852097 GGAACTTCACAGAGGGAGGATGG - Intronic
1030975371 7:116115481-116115503 CACACTTCAAAGATGGAGGAAGG - Intronic
1032383582 7:131506567-131506589 CACTATTCACAGTGAGTGGAGGG - Exonic
1032687878 7:134254044-134254066 CACAATTCACAAAAGGAGTGTGG + Intronic
1034399485 7:150852653-150852675 AACAGGACACAGAGGGAGGAGGG + Intronic
1035659047 8:1333198-1333220 CACATTACAGAGATGGAGGAAGG + Intergenic
1036279041 8:7383529-7383551 ATAAATTGACAGAGGGAGGAAGG + Intronic
1041116164 8:54539627-54539649 CTCTATTAACAGATGGAGGAAGG - Intergenic
1041307720 8:56480005-56480027 CACAAGTAACTGAAGGAGGATGG - Intergenic
1044034796 8:87287384-87287406 CACAGATAACAGAGAGAGGATGG + Intronic
1046037765 8:108864601-108864623 GAAAATTAACAGAGGGATGAAGG + Intergenic
1046518078 8:115289026-115289048 CCCATTTTACATAGGGAGGAGGG + Intergenic
1048232821 8:132660443-132660465 CACACTGCATAGAGGGAGGCGGG + Intronic
1052276613 9:26683621-26683643 GACAACTAGCAGAGGGAGGAAGG - Intergenic
1054799381 9:69332004-69332026 CAGAATTCACAGACGGGGAAAGG - Intronic
1056289221 9:85125925-85125947 CTGAATTCAAAAAGGGAGGAGGG - Intergenic
1056363139 9:85878939-85878961 CACAGATCACTGAGGGAGGCAGG + Intergenic
1056865893 9:90227120-90227142 GACAAGTGACGGAGGGAGGATGG + Intergenic
1059752327 9:117259435-117259457 CCAAATTCCCAAAGGGAGGAGGG - Intronic
1059770539 9:117419787-117419809 AAGAATTGACAGACGGAGGATGG - Intergenic
1061044059 9:128154770-128154792 CACTATTGAAAGAGGCAGGATGG + Intergenic
1061715862 9:132518535-132518557 CACAATTCTGGAAGGGAGGATGG - Intronic
1061735691 9:132656068-132656090 CACAAGTAAGTGAGGGAGGATGG + Intronic
1062719039 9:138025265-138025287 AACAATTCACAGAGGTAGGCTGG - Intronic
1185448561 X:271233-271255 CCCAGGACACAGAGGGAGGAAGG + Intergenic
1185784121 X:2875403-2875425 CCCAGTTCAGAGAGGGTGGAGGG + Intronic
1185829053 X:3281314-3281336 AAAAATTCATGGAGGGAGGAAGG + Intronic
1186178287 X:6948065-6948087 CACAAGTCATGGAGGCAGGAAGG - Intergenic
1186485115 X:9928237-9928259 CACAGTTCCCAGAGGGGAGAGGG - Intronic
1186752928 X:12640428-12640450 CATAATTCACAGAGGCACCAGGG + Intronic
1188820895 X:34773741-34773763 CCCAATTCAGAGAAGGAAGAGGG + Intergenic
1189401114 X:40669572-40669594 CAGATTTCACAGAGAAAGGAGGG - Intronic
1190301708 X:49060839-49060861 CACAATACACAGATGGGGAAGGG + Intronic
1190360313 X:49643151-49643173 CAGAATTCTAAAAGGGAGGAGGG - Intergenic
1191182753 X:57580328-57580350 CACCTTTCACTGAGGGTGGATGG - Intergenic
1191670577 X:63745018-63745040 CACAATTCACAGAGGGAGGAGGG + Intronic
1193547110 X:82844357-82844379 CATAATTAACAGAGGCAGCATGG + Intergenic
1194620481 X:96164788-96164810 GACAATTCGAAGAGGGAGGTAGG - Intergenic
1195575006 X:106439609-106439631 CCCAATTCACAGAAAGAGGGTGG - Intergenic
1197397204 X:125941292-125941314 GACAATTTAAAGAGAGAGGAGGG + Intergenic
1198417489 X:136435268-136435290 CACAATTCACTGAGGGAGATAGG + Intergenic
1200957968 Y:8970565-8970587 CACAAATGGCAGAGGGAGGAGGG - Intergenic