ID: 1191671767

View in Genome Browser
Species Human (GRCh38)
Location X:63754895-63754917
Sequence CTTTCAAAGGGAAAGGCGGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3386
Summary {0: 1, 1: 0, 2: 4, 3: 175, 4: 3206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191671754_1191671767 20 Left 1191671754 X:63754852-63754874 CCAGCATTCTCTCTCGGGCGCCA 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1191671767 X:63754895-63754917 CTTTCAAAGGGAAAGGCGGGGGG 0: 1
1: 0
2: 4
3: 175
4: 3206
1191671758_1191671767 0 Left 1191671758 X:63754872-63754894 CCACGGGAAAGGCAAAATCCTAG 0: 1
1: 0
2: 0
3: 8
4: 113
Right 1191671767 X:63754895-63754917 CTTTCAAAGGGAAAGGCGGGGGG 0: 1
1: 0
2: 4
3: 175
4: 3206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191671767 Original CRISPR CTTTCAAAGGGAAAGGCGGG GGG Exonic
Too many off-targets to display for this crispr