ID: 1191672878

View in Genome Browser
Species Human (GRCh38)
Location X:63765296-63765318
Sequence CTTTCTGAGAAGCAGCTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 419
Summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 372}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191672878_1191672883 4 Left 1191672878 X:63765296-63765318 CCCCTCAGCTGCTTCTCAGAAAG 0: 1
1: 0
2: 2
3: 44
4: 372
Right 1191672883 X:63765323-63765345 GGAAGTAGCACCAGTTCCAAAGG 0: 1
1: 0
2: 1
3: 12
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191672878 Original CRISPR CTTTCTGAGAAGCAGCTGAG GGG (reversed) Intronic
903226021 1:21894610-21894632 CTTCCTGAGAAGCAGCTGTGAGG - Intronic
903499917 1:23795163-23795185 ATGACTGAGAAGCAGCTGAGTGG - Exonic
903943944 1:26950227-26950249 CCTGCTGAGAAGGAGCAGAGTGG + Intronic
904858978 1:33520838-33520860 GTTTCTCAGAAGCAGGGGAGGGG - Intronic
905847697 1:41246499-41246521 CTTTATAAGGAGCAGCTGAAAGG + Intergenic
910347672 1:86259032-86259054 CTTTATGAGGAGCAGCAGGGAGG + Intergenic
913317933 1:117567967-117567989 GTTTCTGAGAAGCAGTGCAGTGG - Intergenic
913510160 1:119553964-119553986 CTTTCAGAAAAGCATCTCAGTGG + Intergenic
913513976 1:119587091-119587113 CTTTCAGAAAAGCATCTCAGTGG + Intergenic
913517652 1:119618066-119618088 CTTTCAGAAAAGCATCTCAGTGG + Intergenic
914045078 1:144084600-144084622 CTTTCTGGAGAGCAGGTGAGGGG - Intergenic
914133032 1:144876086-144876108 CTTTCTGGAGAGCAGGTGAGGGG + Intergenic
914235661 1:145808983-145809005 CTTTCAGATAAACAGCTGATGGG - Intronic
915117709 1:153610904-153610926 CTTTCTAGGAAGCGGCTGATGGG - Intronic
916074376 1:161191822-161191844 CCTTCTGAGACTCAGCTCAGAGG + Intronic
917582513 1:176393098-176393120 ATTTGTGAGATGCAGCTAAGTGG - Intergenic
917616800 1:176754178-176754200 CATTCTGAGAACTAGCTGGGTGG + Intronic
920028543 1:203020276-203020298 CTTTCTGAGAAGGGATTGAGAGG + Intronic
920230954 1:204469278-204469300 CTTTCTGGGAGGCAGGGGAGGGG + Exonic
920433846 1:205935839-205935861 CTTTGGGAGAAGCAGAGGAGGGG + Intronic
921214390 1:212924757-212924779 CTTGCTGGGGAGCAGCTCAGTGG - Intergenic
1063040778 10:2335181-2335203 CTTTCTGAGAAGCTGAAGTGTGG - Intergenic
1064180324 10:13109135-13109157 TTTTCAGTGAGGCAGCTGAGAGG - Exonic
1066787520 10:39021846-39021868 CTTTCTGTGAAACAGCTTTGTGG - Intergenic
1066798711 10:39157931-39157953 CTTTCTGAGAAACTGCTTTGTGG + Intergenic
1066806931 10:39266097-39266119 CTTTCTGAGAAACTGCTTTGTGG - Intergenic
1066929719 10:41742083-41742105 CTTTCTGAGAAACTGCTTTGTGG + Intergenic
1066929931 10:41745361-41745383 CTTTCTGAGAAACTGCTTTGGGG + Intergenic
1066957202 10:42184283-42184305 CTTTCTGGAGAGCAGGTGAGGGG - Intergenic
1067755514 10:49001615-49001637 CATTCTGAGAAGCAGCAGGGAGG + Intergenic
1068244553 10:54347686-54347708 CTCTCTGAGTAGCATCAGAGAGG - Intronic
1068956768 10:62825433-62825455 ATTTCTGAGTAACAGGTGAGAGG - Intronic
1069680893 10:70284224-70284246 CTTCCTGAGAAGGGGATGAGAGG + Intergenic
1069777122 10:70933720-70933742 CTTCCTGAGAGGGAGCAGAGTGG - Intergenic
1070117100 10:73539579-73539601 CACTCTGAAAAACAGCTGAGGGG + Exonic
1071051764 10:81459118-81459140 CTTTCTGAAAAACAGCTCATAGG - Intergenic
1071403259 10:85299609-85299631 ATCCTTGAGAAGCAGCTGAGAGG - Intergenic
1072535242 10:96357427-96357449 CCTTCAGAGACACAGCTGAGTGG + Intronic
1072620478 10:97076011-97076033 CTTGGTGAGCTGCAGCTGAGGGG - Intronic
1073252824 10:102132519-102132541 GTTTCTGAGTAGTAGCAGAGAGG + Intergenic
1076588764 10:131569213-131569235 CTGTCTGAAAAGGAACTGAGGGG + Intergenic
1076648211 10:131969208-131969230 GGTTCTGAAAAGCAGCTGAGGGG + Intronic
1077406328 11:2384032-2384054 GTTTCCAAGAAGCAGCTGAAAGG - Intronic
1077640394 11:3876351-3876373 CTGTTTGGGTAGCAGCTGAGAGG + Intronic
1078436999 11:11333676-11333698 CTTTCTCAGGAGCATCAGAGAGG + Intronic
1078883949 11:15481299-15481321 ATTTCTGAGAAGCATGTGAGTGG - Intergenic
1079574655 11:21988584-21988606 CTTTCTGAGAAGAAGCTTTGAGG - Intergenic
1080050915 11:27858095-27858117 CTGTCTGAGAAGCCCCTGTGTGG + Intergenic
1080373232 11:31676716-31676738 CTCTCTGAGAACTAGCTGTGGGG - Intronic
1081825860 11:46050999-46051021 GTTTCTCAGCAGCAGCTGAATGG - Intronic
1082145498 11:48662536-48662558 CTTTCTGAGAAACTGCTTTGTGG + Intergenic
1082149490 11:48717431-48717453 CTTTCTGAGAAACTGCTTTGTGG - Intergenic
1082149894 11:48725149-48725171 CTTTCTGAGAAACTGCTTTGTGG + Intergenic
1082295266 11:50433941-50433963 CTTTCTGAGAATCTGCTTTGTGG + Intergenic
1082298863 11:50479860-50479882 CTTTCTGAGAAACTGCTTTGGGG - Intergenic
1082300740 11:50502064-50502086 CTTTCTGAGAAACTGCTTTGTGG - Intergenic
1082304249 11:50551517-50551539 CTATCTGAGAAACAGCTTAGTGG - Intergenic
1082305310 11:50565309-50565331 CTTTCTGAGAAGCTGCTTTGTGG - Intergenic
1082306233 11:50579716-50579738 CTTTCTGAGAAACTGCTTTGTGG - Intergenic
1082306618 11:50585376-50585398 CTTTCTGAGAAACAGCTTTGTGG + Intergenic
1082583357 11:54902035-54902057 CTTTCTGAGAAGCTGCTTTGTGG - Intergenic
1082583895 11:54909902-54909924 CTTTCTGAGAAACTGCTTTGTGG - Intergenic
1082584738 11:54922449-54922471 CTTTCTGAGAAACTGCTTTGTGG - Intergenic
1082591044 11:55010251-55010273 CTTTCTGAGAAACTGCTTTGTGG - Intergenic
1082597616 11:55104148-55104170 CTTTCTGAGAAACTGCTTTGTGG + Intergenic
1082598842 11:55122897-55122919 CTTTCTGAGAAACTGCTTTGTGG + Intergenic
1082932619 11:58624370-58624392 CTCTTTGAGAAGAAGCTGTGGGG + Exonic
1083348886 11:62013252-62013274 GTTTCTGAGAAGAAGCTCAGAGG - Intergenic
1083545534 11:63546272-63546294 CTGTGTTAGAAGCAGCTGTGGGG + Exonic
1084911742 11:72395215-72395237 CTTTCTGAGAACAAGGAGAGTGG + Intronic
1084954998 11:72686322-72686344 CGATATGAGAAGCAGCTGTGGGG + Intronic
1085625699 11:78070826-78070848 CTTTCTGAGCTGCAGATTAGTGG - Intronic
1085660562 11:78361997-78362019 CTTTTTAAAAAGCAGCTGAGTGG - Intronic
1086131487 11:83406634-83406656 CTGGCTGAGATGCAACTGAGGGG + Intergenic
1088533748 11:110837992-110838014 ATTTCTGATAAGCAGCTCAGAGG + Intergenic
1089623252 11:119734968-119734990 CTTTCAGAGAGGCAGCTGTTGGG + Intergenic
1089912580 11:122116938-122116960 CTTACTTAGCAGCAGCAGAGAGG + Intergenic
1091769222 12:3140546-3140568 GTTTCTTAGGAGCAGCTGAAGGG + Intronic
1092978318 12:13767985-13768007 CTTTCTGTGAAGGAACAGAGAGG - Intronic
1094112715 12:26878714-26878736 CCTTCTGAGAGGCAGCTGCGAGG - Intergenic
1094400983 12:30060267-30060289 CTTTCTGAGAGGTAGTGGAGGGG - Intergenic
1094857067 12:34408649-34408671 CTTTCTGAGAAACTGCTTTGTGG - Intergenic
1094857948 12:34425281-34425303 CTTTCTGAGAAACTGCTTTGTGG - Intergenic
1094858225 12:34429388-34429410 CTTTCTGAGAATCTGCTTTGTGG - Intergenic
1094858920 12:34436947-34436969 CTTTCTGAGAAACTGCTTAGTGG - Intergenic
1094859366 12:34443945-34443967 ATTTCTGAGAAACAGCTTTGTGG - Intergenic
1094860214 12:34456794-34456816 CTTTCTGAGAAACTGCTATGAGG - Intergenic
1094869678 12:34586963-34586985 CTTTCTGAGAAACTGCTTTGTGG - Intergenic
1094870217 12:34595122-34595144 CTTTCTGAGAAACTGCTTGGTGG + Intergenic
1095065762 12:37771562-37771584 CTTTCTGAGAACCGGTTGTGTGG + Intergenic
1095069740 12:37826273-37826295 CTTTCTGAGAAACTGCTGTGTGG + Intergenic
1095075343 12:37914601-37914623 CTTTCTGAGAAACTGCTTTGTGG - Intergenic
1095806456 12:46325365-46325387 CTTGCTGAGAGGTAGCGGAGGGG + Intergenic
1099289689 12:80761563-80761585 GTTCCTGAGAAACAGCTCAGGGG + Intergenic
1100613089 12:96208501-96208523 CTTTCTGTGAAGGAGCTGGAAGG + Intronic
1100618258 12:96248242-96248264 CTTTCAGCGAAGCAGCTGTTTGG - Intronic
1102315846 12:111886737-111886759 CTTAGTGGGATGCAGCTGAGAGG + Intronic
1104430182 12:128709918-128709940 CCTTGTGAGAAGCAGATGAGAGG + Intergenic
1104431946 12:128723796-128723818 GTACCCGAGAAGCAGCTGAGTGG - Intergenic
1104925563 12:132312469-132312491 CTCTGAGAGAAGCTGCTGAGAGG + Intronic
1104928267 12:132324935-132324957 TGTTCAGAGCAGCAGCTGAGGGG - Intronic
1105211069 13:18257449-18257471 CTGTGTGAGATGCTGCTGAGTGG + Intergenic
1105267980 13:18838178-18838200 CTTGCGGGGAAGCAACTGAGGGG - Intergenic
1106485275 13:30166915-30166937 CTTGCTGAGATGCGGCAGAGTGG - Intergenic
1106535956 13:30643239-30643261 CTTTCTAATACGCTGCTGAGAGG - Intronic
1110260528 13:73479911-73479933 CTGTCTGTGAAGCAAATGAGAGG - Intergenic
1110429381 13:75406242-75406264 CTTTCTGAGTAGCAGTGAAGAGG - Intronic
1110930308 13:81207285-81207307 CTTTTAGAATAGCAGCTGAGAGG + Intergenic
1110945028 13:81403193-81403215 CTTTCTGAGCAGCAGTTTATAGG - Intergenic
1112907483 13:104442820-104442842 GTTTCTGAGAAGCTGAGGAGGGG + Intergenic
1113465688 13:110511429-110511451 TTTTCAGAGAAGGAGCTGGGAGG + Intronic
1114527262 14:23374377-23374399 TTTTCTGAGAAGCAGCTCATGGG - Intronic
1114698977 14:24657604-24657626 CTTCCTGAGTGACAGCTGAGAGG + Intergenic
1115977279 14:39011138-39011160 CTATCTGAGATGCAGGTGGGTGG + Intergenic
1117315387 14:54567009-54567031 CTCCCAGAGAAGCAGCCGAGCGG - Intergenic
1117890654 14:60418368-60418390 CTTTGGGAGAAGAAGGTGAGAGG + Intronic
1118604719 14:67494456-67494478 CTATCAGAGAAGCAGCTGTGGGG + Intronic
1118792512 14:69107990-69108012 CTTTCTGTGAAGCAGCTCCTGGG + Intronic
1118902020 14:69994066-69994088 CTCCCAGGGAAGCAGCTGAGAGG + Intronic
1120907534 14:89633400-89633422 CTGTCTGGGATGCTGCTGAGCGG - Intronic
1121009531 14:90511995-90512017 CCTTCTGAGAGGCAGCTGCCAGG + Intergenic
1121225953 14:92322427-92322449 ATTTCAGAACAGCAGCTGAGGGG - Intergenic
1121811949 14:96899284-96899306 CTTTCTTGGAAGCAGATGAAAGG - Intronic
1202935906 14_KI270725v1_random:87493-87515 CTTTCTGGAGAGCAGGTGAGGGG + Intergenic
1124070770 15:26391134-26391156 CTTTCTGAGATGCCTCAGAGTGG - Intergenic
1125099718 15:35897951-35897973 ATGTCTGAGAAGCAACAGAGTGG - Intergenic
1125426472 15:39554161-39554183 CTTACTGGGAAGCAGATGGGTGG + Intergenic
1126364383 15:47878697-47878719 CTGTATGAAAAGCAGCTGAAAGG + Intergenic
1126796425 15:52263702-52263724 CTTTCTGAGAAGGTGGTGGGTGG - Intronic
1126844077 15:52743032-52743054 CTTGCTGAGAAGTAGTGGAGGGG - Intergenic
1127819261 15:62640702-62640724 CTTTCTGAGGATGAGCTGTGAGG - Intronic
1128059963 15:64729146-64729168 CTTGCTGAGCAGCAGCTGGCAGG + Intergenic
1128446181 15:67763093-67763115 CTTTCTGTTCTGCAGCTGAGCGG + Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1128522986 15:68387719-68387741 CTCTCCTAGAAGCAGCTGAAGGG - Intronic
1128902805 15:71440701-71440723 CTTTCTCAAAAGCAGCTCATAGG + Intronic
1129282568 15:74497453-74497475 CTTTTTGAGAAAGAACTGAGGGG + Intergenic
1129926600 15:79369825-79369847 CCTTCTGAGAAACAGCAAAGAGG - Intronic
1130304820 15:82706243-82706265 CTTTCTGAGAGGTAGTGGAGGGG - Intronic
1131970845 15:97891510-97891532 CTTTGGGAGAACAAGCTGAGTGG - Intergenic
1132232630 15:100195217-100195239 CTGTGTGAGAAGCTGCAGAGGGG - Intronic
1132372942 15:101310504-101310526 TTATCTGAGAACCAGCTGACTGG + Intronic
1132406753 15:101546348-101546370 CTCTCTCAGCTGCAGCTGAGAGG + Intergenic
1133826355 16:9281703-9281725 CTTTCAGAAAACCAGCAGAGAGG - Intergenic
1134384058 16:13755496-13755518 CTTTCTGAGAAGAATCTTACAGG - Intergenic
1134661488 16:15987822-15987844 ATTTCTGAGAAACCGCAGAGAGG - Intronic
1135886103 16:26309659-26309681 CTCATTGAGAAGCAGCTGTGTGG - Intergenic
1136741235 16:32529907-32529929 CTTTCTGAGAATCTGCTTTGAGG - Intergenic
1137252195 16:46748487-46748509 CTCTCTGAGAGGCTGCTGATGGG + Intronic
1137290709 16:47050265-47050287 CTTCCAGAGAAGGAGCTGACTGG - Intergenic
1139166460 16:64571182-64571204 CTGTGTGAGAAGCAGCTGAATGG + Intergenic
1139546680 16:67653011-67653033 CTTCCTCAGCAGCACCTGAGGGG - Exonic
1139884070 16:70196531-70196553 TTCCCTGAGAAGCAGCTGAGAGG + Intergenic
1140368448 16:74398965-74398987 TTCCCTGAGAAGCAGCTGAGAGG - Intergenic
1140954561 16:79849894-79849916 GTTTTTGAGGGGCAGCTGAGAGG - Intergenic
1141570571 16:84931183-84931205 CTTTCTAAGAGGGAGGTGAGGGG - Intergenic
1141652491 16:85401114-85401136 CTTTCTGAGGCCCAGCTGGGTGG + Intergenic
1203012265 16_KI270728v1_random:306918-306940 CTTTCTGAGAAACTGCTTTGTGG + Intergenic
1203028368 16_KI270728v1_random:545327-545349 CTTTCTGAGAATCTGCTTTGAGG + Intergenic
1203030600 16_KI270728v1_random:580077-580099 CTTTCTGAGAAACTGCTTTGTGG + Intergenic
1203041121 16_KI270728v1_random:754354-754376 CTTTCTGAGAAACTGCTTTGTGG - Intergenic
1203043353 16_KI270728v1_random:789104-789126 CTTTCTGAGAATCTGCTTTGAGG - Intergenic
1142862374 17:2770496-2770518 CTTCCTAAGTACCAGCTGAGAGG - Intergenic
1143708745 17:8718626-8718648 CTTCAAGAGATGCAGCTGAGAGG - Intergenic
1144469473 17:15524677-15524699 TTTTCTCAGAAGCAGCTGCTGGG + Intronic
1145796532 17:27658762-27658784 CTTTTGGAGCAGCAGCTGGGTGG + Intergenic
1146356960 17:32142549-32142571 CTTGCGGGGAAGCAACTGAGGGG + Exonic
1147304077 17:39551230-39551252 CTGTCTTAGAAGCAACTTAGGGG + Intronic
1150630254 17:66875513-66875535 CTTTGTGAGAAGGGGTTGAGGGG - Intronic
1151807632 17:76416433-76416455 TTTTCCCAGAAGCAGCTCAGAGG - Intronic
1151951123 17:77354668-77354690 CTTTGGGAGAAGCAGCTGAGGGG + Intronic
1152218596 17:79048713-79048735 CTTTCTGAGTCACAGCTGCGAGG + Exonic
1152237580 17:79146615-79146637 CTCACTGGGGAGCAGCTGAGGGG + Intronic
1152380946 17:79941985-79942007 CTTTCTGAGAACGAGCTGGTGGG + Intronic
1152491487 17:80637506-80637528 TTTTCAGAGAAGCAGGGGAGAGG + Intronic
1152556253 17:81054664-81054686 CTTTGTGAGAAGGAGCTGCAGGG - Intronic
1153293610 18:3524851-3524873 GTGTCTGAGAAGCAGCTGCTGGG - Intronic
1154420037 18:14221864-14221886 CTTGCTGGGAAGCAACTGAGGGG + Intergenic
1155703174 18:28775148-28775170 CTTTCTGTCAACCAGCTCAGTGG + Intergenic
1156633576 18:38999043-38999065 CTTTCTGAGAAGCAGTATAAAGG - Intergenic
1156854300 18:41764504-41764526 CTTTCAGAGAAGTGGCTGCGTGG - Intergenic
1157362610 18:47033552-47033574 CTTTCTGCGATACAGCTGATCGG + Exonic
1157426528 18:47588993-47589015 TTGTGTGAGAGGCAGCTGAGTGG + Intergenic
1159322697 18:66874146-66874168 TGTTCTGAGAAGAAACTGAGAGG + Intergenic
1159897818 18:74013280-74013302 TGTCCCGAGAAGCAGCTGAGGGG + Intergenic
1161418904 19:4164618-4164640 CTTAGTGAGGGGCAGCTGAGTGG - Exonic
1162023344 19:7878986-7879008 ATGACTGAGAAGTAGCTGAGTGG + Intergenic
1164337616 19:24345217-24345239 CTTTCTGAGAAACTGCTTTGTGG + Intergenic
1164359398 19:27486402-27486424 CTTTCTGAGAAACTGCTTTGTGG + Intergenic
1164360928 19:27508782-27508804 TTTTCTGAGAAGCTGCTTTGTGG + Intergenic
1164363982 19:27552965-27552987 CTTTCTGAGAAACTGCTTTGTGG + Intergenic
1164368203 19:27611704-27611726 CTTTCTAAGAAACTGCTGTGTGG + Intergenic
1164368612 19:27618732-27618754 CTTTCTGAGAAACAGCTTTGTGG + Intergenic
1164554300 19:29239007-29239029 CTTACTGAAAAGCTGCAGAGAGG - Intergenic
1164907715 19:31981127-31981149 CCATCTCAGGAGCAGCTGAGAGG + Intergenic
1167500041 19:49840992-49841014 CTCTGTCAGAAGCCGCTGAGAGG + Intergenic
1202684636 1_KI270712v1_random:38004-38026 CTTTCTGGAGAGCAGGTGAGGGG - Intergenic
925185653 2:1844503-1844525 ATTTGTGAGAAGGATCTGAGCGG + Intronic
926132176 2:10310563-10310585 CCTTCTGAGAAGCATCTGTCAGG + Intronic
926302255 2:11612797-11612819 CTTTCTGAGAATCAGGAGAAGGG - Intronic
927134425 2:20086303-20086325 CTTGCTGAGAAGTAGTGGAGGGG - Intergenic
927285008 2:21348034-21348056 AATTCTGAGAAGCTGCAGAGTGG - Intergenic
928584274 2:32742596-32742618 TTCTATGAGCAGCAGCTGAGAGG - Intronic
931679279 2:64730116-64730138 CTCTCTCAGAAGCAGAGGAGTGG + Intronic
933226834 2:79759560-79759582 CTTTATGTGATGCAACTGAGAGG - Intronic
934149375 2:89130730-89130752 CTTTCTGGAGAGCAGGTGAGGGG + Intergenic
934162695 2:89267482-89267504 CTTTCTGAGAAGCCCATGGGTGG - Intergenic
934204579 2:89915042-89915064 CTTTCTGAGAAGCCCATGGGTGG + Intergenic
934217919 2:90051311-90051333 CTTTCTGGAGAGCAGGTGAGGGG - Intergenic
934247081 2:90316842-90316864 CTTTCTGGAGAGCAGGTGAGGGG + Intergenic
934262245 2:91485761-91485783 CTTTCTGGAGAGCAGGTGAGGGG - Intergenic
934305295 2:91816748-91816770 CTTTCTGGAGAGCAGGTGAGGGG - Intergenic
934327962 2:92036000-92036022 CTTTCTGGAGAGCAGGTGAGGGG + Intergenic
934466350 2:94266539-94266561 CTTTCTGGAGAGCAGGTGAGGGG + Intergenic
934886783 2:98032010-98032032 CTTTCTGGGCCGCAGCTGATTGG + Intergenic
935075810 2:99742613-99742635 CTTTCTGGGAATCAACAGAGTGG + Intronic
935644698 2:105324754-105324776 CTTTGGGAGAAGCAGTTAAGTGG + Intronic
935671009 2:105557203-105557225 CTTCCTGAGAAGGAGCTGTGGGG - Intergenic
936040362 2:109145178-109145200 CTGTCTCAGAAGCAGCAGAAAGG - Intronic
936081561 2:109435965-109435987 GTTTCTGCACAGCAGCTGAGAGG - Intronic
936496377 2:113025430-113025452 CATTCTGAGAAACTGCTAAGAGG + Intronic
937594695 2:123659589-123659611 CTTGCTGAGAAGTAGTGGAGTGG + Intergenic
938536050 2:132249251-132249273 CTTTCTGAGAGACATCTGTGTGG - Intronic
939713047 2:145547158-145547180 TTTACTGAGAGGCAGCAGAGTGG + Intergenic
939936404 2:148298650-148298672 CCTTCTGAGAAGAAGAAGAGAGG - Intronic
940019891 2:149145723-149145745 CTTCCTGAGAAGTCTCTGAGGGG - Intronic
943822190 2:192339529-192339551 ATTGCAGAAAAGCAGCTGAGAGG + Intergenic
945770197 2:214033434-214033456 CTTGCTGAGAAGAGACTGAGAGG + Intronic
946184790 2:217974393-217974415 CTTTCTGGGGAGAGGCTGAGGGG - Intronic
946928609 2:224650349-224650371 CGTTCAGAGGAGCAGCTCAGAGG - Intergenic
948806368 2:240455047-240455069 CTTAGTGAGGAGCAGCAGAGTGG + Intronic
1169133807 20:3183499-3183521 CTTGCTGAGAAACAGCTAAAGGG + Intergenic
1169571482 20:6911393-6911415 CCTCCTGGGAAGCACCTGAGAGG - Intergenic
1169717107 20:8632136-8632158 CTTTTTGAGAAGGAACTAAGTGG + Intronic
1170188962 20:13625607-13625629 CTTTCTGACAGTCAGCAGAGAGG - Intronic
1170716547 20:18836496-18836518 ATGTCTGGGAAGCAGCTGAGTGG + Intergenic
1171522815 20:25788358-25788380 CATGCTGAGAGGCAGGTGAGAGG + Intronic
1171530554 20:25850327-25850349 CGTGCTGAGAGGCAGGTGAGAGG + Intronic
1171554012 20:26067525-26067547 CATGCTGAGAGGCAGGTGAGAGG - Intergenic
1172426012 20:34856622-34856644 CCTTCTGAAAAGTAGCTGTGGGG - Intronic
1173132223 20:40404983-40405005 CTGTCTCAGAGGCAGCTGAGAGG + Intergenic
1176085652 20:63294375-63294397 TGCTCTGAGGAGCAGCTGAGGGG - Intronic
1176853254 21:13937447-13937469 CTTGCGGGGAAGCAACTGAGGGG - Intergenic
1179035972 21:37759074-37759096 CTATCTGAGGCTCAGCTGAGTGG + Intronic
1179565750 21:42247530-42247552 CTTTCTGGGAAGCATTTGGGTGG + Intronic
1180587472 22:16905710-16905732 CTTTCTGGAGAGCAGGTGAGGGG + Intergenic
1180765176 22:18341987-18342009 CTGTGTGAGATGCTGCTGAGTGG - Intergenic
1180813854 22:18777697-18777719 CTGTGTGAGATGCTGCTGAGTGG + Intergenic
1181200039 22:21212032-21212054 CTGTGTGAGATGCTGCTGAGTGG + Intronic
1181701696 22:24624927-24624949 CTGTGTGAGATGCTGCTGAGTGG - Intronic
1181797631 22:25321407-25321429 CTCTCTGAGAAGAAGGTGTGGGG + Intergenic
1182191741 22:28468201-28468223 CTCTCTGAGAAAAAGCTGAATGG + Intronic
1182716892 22:32364111-32364133 GTTACTGAGAGGCAGCTGACAGG - Intronic
1182748313 22:32622521-32622543 CTTCCTGAGGGGCAGCTGAGGGG + Intronic
1183635325 22:39058713-39058735 CTTGCTGAGAAGTAGTGGAGTGG + Intronic
1203226797 22_KI270731v1_random:82892-82914 CTGTGTGAGATGCTGCTGAGTGG - Intergenic
1203263953 22_KI270734v1_random:3384-3406 CTGTGTGAGATGCTGCTGAGTGG + Intergenic
949942347 3:9164640-9164662 TTTTCTGAAAAACAGCTCAGAGG + Intronic
952182494 3:30932935-30932957 CTATCAGAGAAACAGATGAGTGG - Intergenic
952828480 3:37543802-37543824 CCCACTGAGAAGCATCTGAGGGG - Intronic
953007212 3:38989634-38989656 CTTTCTGAAAAGAAGTGGAGAGG + Intergenic
953082739 3:39635830-39635852 CATTTGGGGAAGCAGCTGAGTGG - Intergenic
954119252 3:48485826-48485848 CTTTCAGAAGGGCAGCTGAGAGG + Intronic
954375996 3:50194392-50194414 CCCTCTGAGAGCCAGCTGAGCGG + Intronic
956775354 3:72560835-72560857 CTTTCTGAAAAACAGAAGAGAGG + Intergenic
957158562 3:76578550-76578572 CTATGTGAAAAGCAGCTGCGAGG - Intronic
957587851 3:82155650-82155672 CTCCCTGTGAAGCAGCTGAAAGG - Intergenic
958711930 3:97727257-97727279 CTTTCTGAAACTCACCTGAGGGG + Intronic
959277605 3:104296539-104296561 CTTTCTGAGATACAACTCAGTGG - Intergenic
960940493 3:122929909-122929931 CTCTCTGAACAGCAGCTGAAGGG + Intronic
961639135 3:128353904-128353926 CTTTCCCAGCAGCAGGTGAGCGG - Intronic
962830895 3:139139037-139139059 TTTTCTGAGCAGGAGCTGACTGG + Intronic
968148878 3:196321516-196321538 CCGTGTGAGAAGCAGCTGTGAGG + Intronic
968207491 3:196816952-196816974 CTTTCTGATGAACAGCTAAGTGG + Intronic
969574137 4:8026567-8026589 CATCCTGAGCAGCTGCTGAGTGG - Intronic
970584417 4:17501598-17501620 CTATCTGTTAAGCAGCTTAGAGG + Intronic
970972856 4:22005015-22005037 CAGTCTTTGAAGCAGCTGAGAGG + Intergenic
971017895 4:22507388-22507410 CTTCCTGAGAGGCAGCTGAATGG + Intronic
971425997 4:26516076-26516098 CATTCTCAAAAGCAGCAGAGAGG + Intergenic
971762983 4:30792705-30792727 CTATCTCAGTAGGAGCTGAGGGG + Intronic
972936181 4:44138627-44138649 CTTTGTGAGAACCAGCAGTGGGG - Intergenic
974205774 4:58701461-58701483 CTTTCTGAGAAGCAGTTCTTAGG + Intergenic
974960392 4:68692161-68692183 GTGTCTGAGAAGCAACTCAGTGG + Intergenic
975189211 4:71439992-71440014 CTTTGTGAGAAGAAGCTGCTTGG - Intronic
975373965 4:73620650-73620672 CTTTCTTAGGAACAGCTGATAGG + Intergenic
976449029 4:85165941-85165963 CCTTCAGACATGCAGCTGAGGGG - Intergenic
977172390 4:93779499-93779521 CTTTCTCAGGAGAAGCTGGGTGG - Intergenic
977564246 4:98565699-98565721 CTTTATCACAAGCAGCTGAGAGG + Intronic
977788884 4:101074285-101074307 CTTTCTGAGAGGGAGATGAGGGG - Intronic
979872331 4:125839665-125839687 CTTTCTGAAGAGCAGCTGTGTGG + Intergenic
980098956 4:128522342-128522364 ATTTCCAGGAAGCAGCTGAGTGG - Intergenic
982155277 4:152514193-152514215 CTGTCTCAGAAGAAGCTAAGTGG + Intronic
985546751 5:513781-513803 CTTCCTGAGAAGGAGCTGTCAGG - Intronic
985645940 5:1084818-1084840 CTTTTGGAGGAGCAGCTGGGAGG - Intronic
985670429 5:1203909-1203931 CTTTCAGGGAGGCAGCTGAAAGG + Intronic
986614706 5:9604511-9604533 CCTTCTGTAAAGCAGGTGAGGGG + Intergenic
986838156 5:11665301-11665323 CTTTCAGTGAAGCAGCTGGATGG - Intronic
987276458 5:16368408-16368430 CATTCAGAGAAGCAGTTGAATGG - Intergenic
987416739 5:17670389-17670411 CTTGCGCAGGAGCAGCTGAGTGG + Intergenic
987855617 5:23416049-23416071 CTTTCTGTGAACTAGCTGAATGG - Intergenic
988199404 5:28049933-28049955 CTTGCTGAGAAGTAGTGGAGTGG - Intergenic
988501977 5:31791116-31791138 CTTTATCAGAAGCAGATAAGTGG - Intronic
988699615 5:33660569-33660591 CTTTCTGAGACACAACTTAGTGG + Intronic
989537928 5:42585233-42585255 CTTTCTGATACTCAGCTCAGAGG + Intronic
989830337 5:45909252-45909274 CTTTCTGAGAAACGGCTCTGTGG + Intergenic
989831001 5:45918795-45918817 CTTTCTGAGAAACTGCTTTGTGG - Intergenic
989832827 5:45941732-45941754 CTTTCTGAGAAACTGCTTTGTGG + Intergenic
989844279 5:46120790-46120812 CTTTCTGAGAAACTGCTTTGAGG - Intergenic
990112754 5:52348189-52348211 CTTTCTGTGAAACAACTGTGGGG - Intergenic
990296359 5:54405683-54405705 CTTTGTCAGAAGAGGCTGAGTGG + Intergenic
990763985 5:59161939-59161961 CTTTTAGAGAAGCACCTAAGGGG + Intronic
991093941 5:62719734-62719756 CTGTCTGTGCAGCAGCAGAGGGG + Intergenic
992972157 5:82072355-82072377 GGTTCTGGGAAGCAGCTGAGTGG + Intronic
992976237 5:82123684-82123706 CTTTCGGAGACCCAGGTGAGAGG + Intronic
994116438 5:96066508-96066530 CTAGCTGAGAAACAGATGAGAGG - Intergenic
996338823 5:122413876-122413898 CTTTCTTAAAAACAGTTGAGTGG - Intronic
996423124 5:123284228-123284250 ATTTCTGAAAAGCCTCTGAGAGG - Intergenic
997013666 5:129905711-129905733 CTGGCAGAGAAGCAGCGGAGGGG - Intronic
997653830 5:135540964-135540986 GTTTCTGATAACCAGCAGAGAGG - Intergenic
998481107 5:142463626-142463648 CTTCCTGAGAGGCCACTGAGAGG - Intergenic
998521724 5:142807249-142807271 TTTTGTGAGAAGCAACTTAGGGG + Intronic
999298444 5:150475264-150475286 CCCTCTGACCAGCAGCTGAGAGG + Intergenic
999380932 5:151120849-151120871 CTTTGTTAGAAGCAGGTGTGTGG + Intronic
999592664 5:153165976-153165998 CCTTGTGAAAAGCAGCTCAGTGG - Intergenic
999921985 5:156331321-156331343 CTGTCTGAGAGGCAGGTCAGAGG - Intronic
1000607207 5:163337927-163337949 CTTTCTGAGAGGCAGTGGAGTGG - Intergenic
1001489498 5:172145497-172145519 CTTTCTGAGCAGGCTCTGAGCGG - Intronic
1001763043 5:174223358-174223380 GTTTCTGAGAAGCAGATGGCTGG + Intronic
1001892134 5:175348438-175348460 CCTACTGAGAAGCTGCTGTGAGG + Intergenic
1003035046 6:2634482-2634504 CTTTCTCGGAAGCAGCTGGGGGG + Intronic
1003217855 6:4131471-4131493 ATTTCTGAAAAGTAGCTGAGTGG - Intronic
1004701104 6:18080328-18080350 CTTTCTTAGAGCCAGCTGTGCGG - Intergenic
1005642543 6:27810246-27810268 CTTTCTGATCAGCAGCTCGGTGG - Exonic
1006327448 6:33365092-33365114 ATGACTGAGAAGCAGCTGAGTGG + Intergenic
1006777091 6:36602991-36603013 TTTTATAAGAAACAGCTGAGAGG + Exonic
1006924760 6:37648265-37648287 GTTCCAGAGAAGCTGCTGAGGGG + Intronic
1009063989 6:58434272-58434294 CTTTCTGAGAAACTGCTTTGTGG + Intergenic
1009251874 6:61311905-61311927 CTTTCTGAGAAACTGCTTTGTGG + Intergenic
1010841075 6:80649697-80649719 CTTACTGAGAGGCAGTGGAGGGG + Intergenic
1012966188 6:105676056-105676078 CTTTCTGACCAGCAATTGAGAGG + Intergenic
1013150327 6:107439633-107439655 GATCCTGAGAATCAGCTGAGAGG + Intronic
1016571486 6:145518395-145518417 CTTTCTCAGAATTGGCTGAGTGG - Intronic
1018012185 6:159681352-159681374 GTTTCTGAAAAGTAGCTCAGGGG - Exonic
1019716256 7:2540843-2540865 CTCTCTGAGCAGCAGCTCTGTGG + Intronic
1019831881 7:3338535-3338557 CTTTGTGAGAAGCAGTGGAGAGG + Intronic
1020565513 7:9789496-9789518 CTTGTTGAGAAACAGCTAAGTGG + Intergenic
1022534463 7:31087175-31087197 CTGGCTGAGACGCAGCTGGGTGG - Intronic
1023546727 7:41325483-41325505 TTTTCTGGGATGCAGATGAGGGG - Intergenic
1023905920 7:44521534-44521556 CTCTGTGAGAAGCACCTGTGTGG - Intronic
1024663269 7:51520085-51520107 CCTTCTGAGAGGAGGCTGAGAGG - Intergenic
1024672812 7:51612155-51612177 CTTCCTGGAAAGCAGCAGAGAGG + Intergenic
1025525657 7:61806439-61806461 CTTTCTGAGAAACTGCTTTGTGG - Intergenic
1025531038 7:61883963-61883985 CTTTCTGAGAATCTGCTTTGAGG - Intergenic
1025549048 7:62219171-62219193 CTTTCTGAGAAACTGCTTTGTGG - Intergenic
1025575165 7:62629255-62629277 CTTTCTGAGAAACTGCTTTGTGG - Intergenic
1025588609 7:62825905-62825927 CTTTCTGAGAAACTGCTTTGAGG + Intergenic
1025590169 7:62849100-62849122 CTTTCTGAGAAACTGCTTTGTGG + Intergenic
1025592871 7:62885000-62885022 CTTTCTGAGAACCTGCTTTGTGG + Intergenic
1025599958 7:62984440-62984462 CTTTCTGAGAAACTGCTTTGTGG + Intergenic
1026620268 7:71944107-71944129 CCTTCTGAGAAGGAGCTCAGTGG + Intronic
1030079834 7:105767777-105767799 CTATCGGAGAGGCAGCAGAGGGG - Intronic
1030868802 7:114731779-114731801 CAGCCTGTGAAGCAGCTGAGAGG + Intergenic
1032715132 7:134502269-134502291 CTTGCTGAGAGGCATCTGAGTGG - Intergenic
1033015411 7:137665908-137665930 CTTCCTGAGAAGCAGCCAATCGG + Intronic
1034593088 7:152160495-152160517 CATTCTGAGAAGCAGGTGTGTGG + Intronic
1035300184 7:157891940-157891962 GAATCTGAGAAGAAGCTGAGGGG - Intronic
1035366669 7:158352846-158352868 CTTTCTGAGCTGCAGCTGCCTGG + Intronic
1035414415 7:158670884-158670906 ATTTCTGAGAAGCTACTGTGTGG + Intronic
1035543248 8:458537-458559 TTTGCTGAAAAGCAGGTGAGTGG + Exonic
1036757010 8:11477402-11477424 CCTTCAGAGAAGGGGCTGAGAGG - Intergenic
1036782128 8:11657041-11657063 GTTTCTGAGAAGTGGCTGGGAGG - Intergenic
1040691225 8:49941053-49941075 CTTTGTGGGATGCATCTGAGTGG + Intronic
1040914990 8:52559637-52559659 CTGTTTCAGAACCAGCTGAGAGG - Intronic
1041027598 8:53703215-53703237 GTTTCTGGGAAGCAACTCAGTGG - Intergenic
1044476702 8:92634969-92634991 CATTCTGAGAAGCAGCCACGGGG + Intergenic
1047235524 8:123039023-123039045 TTTTCACAGGAGCAGCTGAGTGG - Intronic
1047763147 8:127968934-127968956 CTGTCTGTGAAGCCTCTGAGGGG - Intergenic
1047817261 8:128478257-128478279 GTTTCAGAGAAGTAGGTGAGTGG + Intergenic
1048007192 8:130428952-130428974 CTCTCTGAGAAGAACCGGAGAGG - Intronic
1049256984 8:141619418-141619440 CTGTATGAGAAGCAGCTGGGAGG - Intergenic
1049661047 8:143819892-143819914 CTCTCTGGGAAGCATCTGAATGG - Intronic
1049721010 8:144115552-144115574 CACTCTGAGACGGAGCTGAGGGG - Exonic
1051609033 9:18943537-18943559 CCATCTGAAAACCAGCTGAGTGG + Intronic
1051719812 9:20024882-20024904 CTTACTGAGAAACACCTGAGGGG + Intergenic
1052256586 9:26464530-26464552 ATTTTTGAGATGCAGTTGAGTGG - Intergenic
1053234042 9:36436371-36436393 CTTTCAGAAAAGGAGCTGAATGG - Intronic
1053367192 9:37531343-37531365 CTTCCTGAGAAGCAGGTTTGGGG - Intronic
1053696398 9:40643310-40643332 CTTTCTGGAGAGCAGGTGAGGGG + Intergenic
1054307649 9:63442538-63442560 CTTTCTGGAGAGCAGGTGAGGGG + Intergenic
1054406376 9:64766540-64766562 CTTTCTGGAGAGCAGGTGAGGGG + Intergenic
1054440003 9:65252013-65252035 CTTTCTGGAGAGCAGGTGAGGGG + Intergenic
1054490402 9:65769926-65769948 CTTTCTGGAGAGCAGGTGAGGGG - Intergenic
1055488701 9:76782359-76782381 ATTTCTGAGAGGCAGGTCAGTGG + Intronic
1055624376 9:78159698-78159720 ATTTCTGAGGTGCATCTGAGTGG + Intergenic
1056378163 9:86034454-86034476 CTTTGTGACCAGCCGCTGAGGGG + Intronic
1056707276 9:88961805-88961827 CTTTCCCAGAAGCAGAAGAGGGG + Intergenic
1058734687 9:107883494-107883516 CTTTATGAGAAGCTGGGGAGGGG + Intergenic
1059446228 9:114339770-114339792 CTTGCTTAGACTCAGCTGAGAGG + Intronic
1061615417 9:131775773-131775795 CCTTCTGAGAAGCAGGGAAGGGG - Intergenic
1061876512 9:133546747-133546769 CTACCTGTGAAGAAGCTGAGGGG - Intronic
1062595552 9:137297474-137297496 CATTCCTAGAAGCAGCTCAGTGG - Intergenic
1202778846 9_KI270717v1_random:16971-16993 CTTTCTGGAGAGCAGGTGAGGGG + Intergenic
1203585921 Un_KI270747v1:3379-3401 CTTTCTGGAGAGCAGGTGAGGGG + Intergenic
1186055436 X:5644583-5644605 ATTTCTGAAAAACAACTGAGGGG + Intergenic
1191268441 X:58429321-58429343 CTTTCTGAGAAACCGCTATGTGG - Intergenic
1191672878 X:63765296-63765318 CTTTCTGAGAAGCAGCTGAGGGG - Intronic
1194390600 X:93312943-93312965 CTTTCTGAGAAACGGCGGGGTGG + Intergenic
1194419251 X:93651771-93651793 ATTTCTGAGAAACAGCAGAGAGG - Intergenic
1194873489 X:99160875-99160897 CTTGCTGAGAGGCAGTGGAGGGG + Intergenic
1194956956 X:100192140-100192162 TTTTCTGTGAAGCTGCTGATGGG - Intergenic
1195454583 X:105053116-105053138 TTTGATGAGAAACAGCTGAGGGG - Intronic
1196440079 X:115711506-115711528 CTTTTTGAGAAGCTGGTGAATGG - Intergenic
1197253639 X:124240014-124240036 GTTTCTGAGAAGAAGCTTTGGGG - Intronic
1200397425 X:155999364-155999386 CTTTCAGAGAAGAGGATGAGGGG - Intronic
1200448362 Y:3293323-3293345 CTTCCTGAGAAACTGCTGAGAGG - Intergenic
1201194142 Y:11475243-11475265 CTTTCTGGAGAGCAGGTGAGTGG + Intergenic
1201233982 Y:11892547-11892569 CTTTCTGAGAGGTAGTGGAGGGG + Intergenic
1201724558 Y:17138462-17138484 CTTGCTGAGAAGTAGTGGAGTGG + Intergenic
1201727698 Y:17171520-17171542 CATTCTGAGAGGCAAGTGAGTGG - Intergenic