ID: 1191675276

View in Genome Browser
Species Human (GRCh38)
Location X:63786082-63786104
Sequence TGGGGGAATCATAAAGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191675276_1191675287 3 Left 1191675276 X:63786082-63786104 CCCACCTCTTTATGATTCCCCCA No data
Right 1191675287 X:63786108-63786130 CTGGGGAACACAACACAGGCTGG No data
1191675276_1191675286 -1 Left 1191675276 X:63786082-63786104 CCCACCTCTTTATGATTCCCCCA No data
Right 1191675286 X:63786104-63786126 AACTCTGGGGAACACAACACAGG No data
1191675276_1191675288 17 Left 1191675276 X:63786082-63786104 CCCACCTCTTTATGATTCCCCCA No data
Right 1191675288 X:63786122-63786144 ACAGGCTGGTACCTTTGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191675276 Original CRISPR TGGGGGAATCATAAAGAGGT GGG (reversed) Intergenic
No off target data available for this crispr