ID: 1191677715

View in Genome Browser
Species Human (GRCh38)
Location X:63809253-63809275
Sequence CAGGGTAGCCAGGCAGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 442
Summary {0: 1, 1: 1, 2: 3, 3: 38, 4: 399}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191677715_1191677719 5 Left 1191677715 X:63809253-63809275 CCAGCAACTGCCTGGCTACCCTG 0: 1
1: 1
2: 3
3: 38
4: 399
Right 1191677719 X:63809281-63809303 TGCATCTCCAGCTCCAGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191677715 Original CRISPR CAGGGTAGCCAGGCAGTTGC TGG (reversed) Intergenic
900068546 1:751370-751392 CGAGGTGGCCAGGGAGTTGCTGG - Intergenic
900100966 1:961908-961930 CCGGATACCCAGGCAGTTGGAGG - Exonic
900389292 1:2427128-2427150 CAGGGTAGCAGGGAAGTAGCAGG + Intronic
900694137 1:3999752-3999774 CAGGGTGGGCATGGAGTTGCAGG + Intergenic
901209055 1:7514318-7514340 CAGGGCAGACAGGCAGTGCCTGG + Intronic
901533375 1:9867331-9867353 ATGGGGAGCCAGGCAGGTGCTGG - Intronic
901738033 1:11324704-11324726 CAGGGTGGCCCGGCACTTCCCGG + Intergenic
902564779 1:17304340-17304362 CAGGCTAGCCAGCCAGTCTCTGG + Intergenic
904011843 1:27394319-27394341 CAGGCCATCCAGGCAGTTCCAGG - Exonic
904445413 1:30569924-30569946 AAGGTTAGAAAGGCAGTTGCTGG - Intergenic
904537175 1:31207575-31207597 CAGGGGGGTCAGGCAGCTGCTGG - Intronic
904972970 1:34433574-34433596 CAGGGAAGGAAGCCAGTTGCAGG + Intergenic
905819925 1:40980890-40980912 CAGGGTGAACAGGCAGGTGCAGG - Intronic
906491366 1:46271322-46271344 CCAGGTAGCCAGGCAGTTGTTGG - Intronic
906911072 1:49951484-49951506 AAGGTTGGACAGGCAGTTGCTGG - Intronic
907019186 1:51048867-51048889 AAGGCTGGACAGGCAGTTGCTGG - Intergenic
908711292 1:67018555-67018577 CAGGGTTTCCAGGCAATTGTCGG - Intronic
908973089 1:69862032-69862054 CAGGGTAGCAGGGCAGTCTCTGG + Intronic
912541377 1:110418675-110418697 AAGGTTGGACAGGCAGTTGCTGG + Intergenic
912698222 1:111856902-111856924 CAAGGTAGACAGGCAGCTGCTGG - Intronic
912958431 1:114173277-114173299 CAGTGCTGCCAGGCAGTTACTGG + Intergenic
913347665 1:117824731-117824753 CAGGGAAGCCAGGGATTTGGTGG + Intergenic
916617479 1:166457652-166457674 CAGGGGAGCCAGGCTGGTGAAGG + Intergenic
921460727 1:215423478-215423500 AAGGTTGGACAGGCAGTTGCTGG - Intergenic
921788528 1:219262857-219262879 CTGGTTAGCCAGGACGTTGCAGG + Intergenic
922780243 1:228246725-228246747 CAGGCAGGCCAGGCAGATGCTGG + Exonic
922842636 1:228655978-228656000 CAAGATTGTCAGGCAGTTGCTGG - Intergenic
923017818 1:230140361-230140383 CAGTGGAGCCAGGCAGTGGCAGG - Intronic
923282513 1:232457903-232457925 CAGGGCACCCAGACAGTTGCAGG + Intronic
924323975 1:242876934-242876956 GAGGTTAGACAGGCAGTTGCTGG + Intergenic
1063141806 10:3262497-3262519 GAGGCTGGACAGGCAGTTGCTGG + Intergenic
1064944337 10:20771316-20771338 CCAGGTTGACAGGCAGTTGCTGG - Intergenic
1064990805 10:21255139-21255161 CAGGGTAGCCTGGCAGGGACTGG - Intergenic
1065563833 10:26989597-26989619 CAGGGTTGACAGACAATTGCTGG + Intergenic
1067432949 10:46255904-46255926 TAGGTTGGCCAGGCAGTTGCTGG - Intergenic
1067439212 10:46299116-46299138 CAGGAAGGCCAGGCAGGTGCAGG + Intronic
1067473139 10:46550225-46550247 CAGGGTGGCCAGGCCCCTGCAGG - Exonic
1067581458 10:47449204-47449226 CAGGAAGGCCAGGCAGGTGCAGG + Intergenic
1069683321 10:70300478-70300500 CAAGGCAGCCAGGCTGCTGCTGG + Exonic
1070799270 10:79235549-79235571 CAGGGCTGCCAGGGAGTAGCAGG - Intronic
1071178687 10:82957664-82957686 AAGGGTGGACAGGAAGTTGCTGG - Intronic
1072871694 10:99126615-99126637 CTGGTTAGCCAGGATGTTGCAGG - Intronic
1074037345 10:109753695-109753717 CTGGTTAGCCAGGGTGTTGCAGG + Intergenic
1074046188 10:109841465-109841487 TAGGGTAGCCTGGCATTTGATGG - Intergenic
1075054198 10:119206299-119206321 CAGGGCTGCCAGGAAGTCGCAGG - Intergenic
1075173703 10:120139990-120140012 AAGGTTGGACAGGCAGTTGCTGG + Intergenic
1076993393 11:287374-287396 CAGGGAACCCAGGCAGGTGCAGG + Intergenic
1076993421 11:287496-287518 CAGGGAACCCAGGCAGGTGCAGG + Intergenic
1076993451 11:287618-287640 CAGGGAACCCAGGAAGGTGCAGG + Intergenic
1076993480 11:287740-287762 CAGGGAACCAAGGCAGGTGCAGG + Intergenic
1076993508 11:287862-287884 CAGGGAACCCAGGCAGTTGCAGG + Intergenic
1077050815 11:565992-566014 CAGGGAAGCCAGGCAGCAGCAGG + Intergenic
1077277702 11:1723014-1723036 CAGACCAGCCAGGCTGTTGCAGG + Intergenic
1077309652 11:1882675-1882697 CTGTGCAGCCAGGCAGGTGCAGG - Intronic
1078576105 11:12503910-12503932 CCTGGAAGCCAGGCAGATGCCGG - Intronic
1078687806 11:13549365-13549387 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
1078706057 11:13745329-13745351 CAGGCTAGCCAGGAAGATGTTGG - Intergenic
1079137162 11:17782043-17782065 CAGGGTAATCATACAGTTGCAGG - Exonic
1079306453 11:19327871-19327893 CATGGTTGCCAGGCAATTGCTGG + Intergenic
1079356721 11:19735979-19736001 ACTGGTAGCCAGGCAGGTGCTGG - Intronic
1079424303 11:20325688-20325710 AAGGTTGGACAGGCAGTTGCTGG + Intergenic
1082172887 11:49027138-49027160 CAGGGTGGTCAGTCAGTTGGTGG + Intergenic
1082683452 11:56208512-56208534 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1083402870 11:62436138-62436160 CAGGGTGGGGAGGAAGTTGCAGG + Intronic
1083443974 11:62694932-62694954 CAGGGTAGCCAGTCTGATTCAGG - Intronic
1083764488 11:64835480-64835502 CAGGTGAGCCAGGCAGCTGGTGG - Exonic
1083932185 11:65852152-65852174 CAGGGGAGGGAGGCAGTGGCTGG - Intronic
1084086722 11:66858346-66858368 CAGCGTGGCCAGGCGGTTGGAGG - Exonic
1084186076 11:67472377-67472399 CAGCGTAGCAAGGCTGATGCAGG + Intergenic
1084188962 11:67490312-67490334 CAGGGGACCCAGGCTGTTCCTGG - Exonic
1084302087 11:68258588-68258610 CAGAGTGGGCAGGCAGTTGGTGG + Intergenic
1084976130 11:72799637-72799659 GGGGTTAGCCAGGCAGTTGCTGG + Intergenic
1086315647 11:85589192-85589214 CTGGTTAGCCAGGATGTTGCAGG + Intronic
1086692883 11:89808920-89808942 CAGGGTGGTCAGTCAGTTGGTGG - Intergenic
1086712917 11:90030739-90030761 CAGGGTGGTCAGTCAGTTGGTGG + Intergenic
1086953200 11:92911539-92911561 CGGGAGAGCCAGGCAGGTGCAGG - Intergenic
1088413700 11:109566564-109566586 CTGGGTAGCCAGGATGTTACAGG + Intergenic
1088506189 11:110529899-110529921 CAGGGTGGCCAGGCAAGTCCTGG + Intergenic
1089362968 11:117903399-117903421 CAGGCCAGGCAGGCAGTTGCTGG - Intronic
1089364233 11:117911310-117911332 CAGGGTAGACAGGCAGCAGTAGG - Intronic
1092602590 12:10082820-10082842 CTGGTTAGCCAGGATGTTGCAGG - Intronic
1093191980 12:16085312-16085334 CAGTGTAGCCTGACAGCTGCAGG - Intergenic
1094799728 12:34019179-34019201 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1095112517 12:38313498-38313520 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1095554353 12:43482962-43482984 CTGGTTAGCCAGGCTGATGCAGG - Intronic
1095925487 12:47575342-47575364 CAGTGTCCCCACGCAGTTGCAGG + Intergenic
1096829031 12:54300478-54300500 CAGGGTAGCCCACCAGTTGAAGG + Intronic
1096956415 12:55530312-55530334 CTGGTTAGCCAGGGTGTTGCCGG - Intergenic
1098786346 12:74761570-74761592 GAGGTTAGACAGGCAGTTGCTGG - Intergenic
1099310360 12:81012851-81012873 GAGGTTGGACAGGCAGTTGCTGG - Intronic
1099502668 12:83432719-83432741 CAGGGAAGCCCTGCAGCTGCAGG + Intergenic
1099795101 12:87390310-87390332 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
1100017096 12:90024244-90024266 CCTGGAAGCCAGGGAGTTGCTGG + Intergenic
1100227648 12:92575016-92575038 CAGGGAAGCCAGGCAGCTCTGGG - Intergenic
1100421215 12:94435756-94435778 CTGATTAGCCAGGGAGTTGCAGG - Intronic
1101503437 12:105325607-105325629 CAGGTTCGACAGGCAGTTGCTGG + Intronic
1101622435 12:106401959-106401981 CAGGGCAATCAGGCAGTTGAAGG + Intronic
1102215894 12:111161113-111161135 CAGGGCAGCCAGGCAAGGGCTGG - Intronic
1102407592 12:112687211-112687233 AAGTCTAGACAGGCAGTTGCTGG + Intronic
1104839145 12:131812574-131812596 AAGGTTAGACAGGCAATTGCTGG - Intergenic
1104928383 12:132325543-132325565 CACTGTGGCCAGCCAGTTGCTGG - Intronic
1105068971 12:133222399-133222421 CCGGGTACCCAGGCAGCAGCAGG + Intronic
1107361212 13:39619275-39619297 CTGGTTAGCCAGGATGTTGCAGG - Intergenic
1112448370 13:99487765-99487787 CAGGGTTTCCAGCCAGTTCCAGG - Intergenic
1112673203 13:101665907-101665929 AAGGTTAGGCAGGCAGTTGCTGG - Intronic
1113127129 13:106991774-106991796 CTGGGTAGCCAGGCAGTGATGGG - Intergenic
1113196080 13:107808123-107808145 AAGGTTGGACAGGCAGTTGCGGG + Intronic
1113386497 13:109853388-109853410 CGGGGCAGACAGGCAGTTGCTGG - Intergenic
1114525490 14:23365202-23365224 CAGGCTAGCCAGGCAGGAGGAGG + Exonic
1117327816 14:54684960-54684982 GAGGGTGGCCAGGAAGCTGCAGG + Intronic
1120266939 14:82263101-82263123 CAAGGTAGATAGGCAGCTGCTGG - Intergenic
1121278056 14:92680998-92681020 CAGGTGACCCAGGCAGCTGCTGG + Intronic
1121647650 14:95530894-95530916 CAGGGAATCCAGGTAGTTCCAGG + Intergenic
1121660607 14:95632509-95632531 CAGGGCAGAGAGGCAGCTGCTGG - Intergenic
1121694892 14:95904464-95904486 CAAGGCAACCAGGCAGGTGCAGG + Intergenic
1121802178 14:96783904-96783926 GAGGTTAGACAGGCAATTGCTGG + Intergenic
1122668034 14:103347564-103347586 AAGGTTGGACAGGCAGTTGCTGG - Intergenic
1122823210 14:104357358-104357380 CAGGGGAGCAAGGCAGATGCTGG + Intergenic
1123035184 14:105469073-105469095 CAGGGCAGCCACGCTGTGGCCGG - Intronic
1123114331 14:105887096-105887118 CAGGGCAGGCAGGCACCTGCTGG - Intergenic
1127847649 15:62885436-62885458 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1129068998 15:72935739-72935761 CAGGGCAGCCTGGAAGATGCAGG - Intergenic
1130902212 15:88215547-88215569 CAGGGGAGCCAGGCTGGGGCTGG + Intronic
1130972801 15:88747244-88747266 CAGGGTAGCCAGGCTCAGGCAGG + Intergenic
1131047700 15:89326613-89326635 CAGGGTGTCCAGGAAGGTGCTGG + Exonic
1131232095 15:90666802-90666824 GAGGGTGGCCAGGCAGCTCCTGG + Intergenic
1131248261 15:90814505-90814527 CAGGTGAGCCAGGGAGCTGCTGG + Intronic
1131259903 15:90882855-90882877 CAGGGCAGCCAGGGAGGAGCAGG - Exonic
1132184695 15:99792743-99792765 CAGGGTGGGCAGGCAGGGGCAGG + Intergenic
1132432288 15:101771911-101771933 CAGGGTGGGCAGGCAGGGGCAGG - Intergenic
1132721617 16:1319291-1319313 CAGGACAGCCACGCAGCTGCTGG + Intronic
1133774835 16:8888156-8888178 CAGAGCAGCCAGGCTGTGGCAGG + Intergenic
1134210449 16:12272046-12272068 CAAGGAAGTCAGGTAGTTGCAGG + Intronic
1134232446 16:12439240-12439262 CATGGTAGACATGCAGCTGCTGG - Intronic
1135196988 16:20402907-20402929 CAGGCTAGAAAGGCAGGTGCCGG - Intronic
1135663898 16:24319373-24319395 GAGGTTGGACAGGCAGTTGCTGG + Intronic
1136994161 16:35176776-35176798 CAGTGGAGGCAGGCAGATGCCGG - Intergenic
1138193684 16:55036565-55036587 GAGGGCAGCAAGGCAGTTCCCGG - Intergenic
1138439748 16:57026883-57026905 CAGGGTGGCCAGGTCGGTGCAGG - Exonic
1138598672 16:58042574-58042596 CAAGGTGGCCAGGCACTTCCGGG - Intronic
1139140841 16:64260694-64260716 CAGTACAGCCAGCCAGTTGCTGG + Intergenic
1139581730 16:67877851-67877873 CAGGGGAGGCAGGCAGTCACAGG - Intronic
1141152553 16:81574276-81574298 CAGGGTGGCCAAGCAGTTGGAGG - Intronic
1141811875 16:86381367-86381389 CAGGGAAGCGTGGCAGATGCCGG - Intergenic
1141828395 16:86496464-86496486 CAGGGCAGCCAGGCTGATGCGGG - Intergenic
1144767263 17:17739637-17739659 CAGGGGAAGCAGGCAGGTGCTGG - Intronic
1145273014 17:21414678-21414700 CAAGGTGGCGAGGCAGTGGCAGG + Intronic
1145311215 17:21702122-21702144 CAAGGTGGCGAGGCAGTGGCAGG + Intronic
1145887930 17:28395832-28395854 CCTTGTAGCCAGGCAGGTGCTGG - Exonic
1145933538 17:28702149-28702171 AAGGGCAGCCAGGCAGGGGCTGG - Exonic
1148157990 17:45434216-45434238 CAGCACAGCCAGGCAGTGGCTGG + Intronic
1148224551 17:45889583-45889605 CATGCCAGCCAGGCAGTTGTTGG - Intergenic
1149296005 17:55263681-55263703 CAGGGCAGAAAGGCACTTGCCGG + Intergenic
1149574894 17:57704731-57704753 CAGGAAGGCCAGTCAGTTGCAGG - Intergenic
1150617658 17:66784747-66784769 CAGGGCAGGCAGGCAGTGGTGGG - Intronic
1150953436 17:69827651-69827673 GAGGTTAGGGAGGCAGTTGCTGG + Intergenic
1151445423 17:74160574-74160596 CAGGGTGGCATGGCAGGTGCTGG - Intergenic
1151798153 17:76360537-76360559 CAGGTTGTACAGGCAGTTGCTGG + Intronic
1152227609 17:79099779-79099801 CAGGCCAGCCAGGCAGTCTCAGG - Intronic
1152704520 17:81835913-81835935 CAGGGGAGCCAGGCACGTGGAGG - Intergenic
1152811107 17:82383269-82383291 CAGGGGAGCCTGGCAGTGGTCGG - Intergenic
1152828695 17:82483965-82483987 CAGGGCTGCCAGGGAGTTGAAGG + Intronic
1152887502 17:82860938-82860960 CAGGGTGGCCAGGGACTTGGCGG + Intronic
1153772315 18:8425930-8425952 CAGGGAAGCCCTGCAGGTGCTGG - Intergenic
1156041229 18:32825234-32825256 CAGAGTATCCAGGAAGTGGCTGG - Intergenic
1156309501 18:35909144-35909166 CAGGGAAGTCAGGCCTTTGCTGG - Intergenic
1158141250 18:54258764-54258786 TGGGGTAGGCAGGCAGATGCAGG - Intergenic
1162141305 19:8586937-8586959 CAGGGGAGGCAGGCAGGTGTTGG - Intronic
1163309443 19:16504469-16504491 CAGGGCAGCCAGCCAGCTGGGGG - Intronic
1163417265 19:17194323-17194345 CAAGGCAGCCAGGCAGACGCAGG + Intronic
1165061986 19:33209288-33209310 CAGGTGAGCCGGGCAGCTGCAGG - Exonic
1165304541 19:34995433-34995455 CAGGGTGGCCAGGCAGTATCTGG - Intronic
1167226867 19:48250324-48250346 GAGGTTGGACAGGCAGTTGCTGG + Intronic
1167781729 19:51602737-51602759 CAGGTTAGGCAGGAAGTTTCTGG - Intergenic
1168407550 19:56118843-56118865 CAGGGCAGCCAGGCAGTTGCTGG + Intronic
1168686338 19:58351593-58351615 CAGGGGAGCCACGCAGGTGAGGG + Exonic
925198550 2:1947584-1947606 CAAGGGAGCCAGCCAGCTGCAGG - Intronic
925562464 2:5211637-5211659 CAGGGTGGCCAGGCCTTGGCGGG - Intergenic
925902419 2:8518083-8518105 CAGGATGTCCAGGCAGGTGCAGG - Intergenic
926109282 2:10171701-10171723 CAGGGCAGCCGGGCAGAGGCAGG + Intronic
926459123 2:13106546-13106568 AAGGTTAGGCAAGCAGTTGCCGG - Intergenic
927578711 2:24222479-24222501 GAGGTTGGACAGGCAGTTGCTGG - Intronic
928105913 2:28470514-28470536 CAGGGTCGGAAGGCAGGTGCTGG + Intronic
928818475 2:35329126-35329148 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
929933605 2:46277304-46277326 CAATGTAGCCAGACACTTGCCGG - Intergenic
930520734 2:52463647-52463669 AAGGTTGGACAGGCAGTTGCTGG + Intergenic
931376372 2:61712065-61712087 CAGGGCAGCTAAGCACTTGCAGG - Intergenic
931634662 2:64330519-64330541 GAGGGCAGCCAGACAGTGGCAGG + Intergenic
932822262 2:74911612-74911634 CAGGGTCAGCAGGCAGCTGCAGG - Intergenic
933033168 2:77358241-77358263 CAAAGAAGCCAGGCAGATGCTGG - Intronic
933245838 2:79973814-79973836 AAGGTTGGACAGGCAGTTGCTGG + Intronic
934111362 2:88746781-88746803 CTGGTTAGCCAGGATGTTGCAGG + Intronic
935065148 2:99641037-99641059 CAGGGTGGACAGGGAGTGGCAGG - Intronic
935182663 2:100704532-100704554 CAGGCTTGCCAGCCAGTTGCTGG - Intergenic
935651686 2:105387467-105387489 CAGGGTACCTGGGCAGCTGCAGG - Intronic
936473609 2:112820537-112820559 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
936559373 2:113523449-113523471 CAGGTTGGACAGGCAGTTGTTGG - Intergenic
936608660 2:113980480-113980502 AAGGTTAGACAGGCAGTTGCTGG + Intergenic
936622673 2:114116832-114116854 GAGGGAAGCCAGGCTGTGGCTGG + Intergenic
937277036 2:120691541-120691563 CAGGAGAGACAGGCAGCTGCTGG + Intergenic
937332227 2:121038686-121038708 CAGGGTAGGGAGTCAGTTCCAGG + Intergenic
938854825 2:135298843-135298865 CAGGTTAGCCAGGATGTTACAGG + Intronic
938900215 2:135793089-135793111 CTGGTTAGCCAGGATGTTGCAGG - Intronic
939305186 2:140401841-140401863 CTGGTTAGCCAGGGTGTTGCAGG - Intronic
939919188 2:148087343-148087365 CTGGTTAGCCAGGATGTTGCAGG - Intronic
940387464 2:153090469-153090491 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
940630369 2:156230338-156230360 CTGGTTAGCCAGGATGTTGCAGG - Intergenic
943607809 2:189997114-189997136 CTGGTTAGCCAGGGTGTTGCAGG + Intronic
944263709 2:197701440-197701462 CTGGTTAGCCAGGATGTTGCAGG + Intronic
945067862 2:205962191-205962213 CAGGGTGGCCAGTCAGTGGATGG - Intergenic
945287875 2:208100258-208100280 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
945338225 2:208618109-208618131 CTGGTTAGCCAGGATGTTGCAGG + Intronic
945673464 2:212830040-212830062 AAGGTTGGACAGGCAGTTGCTGG + Intergenic
946066345 2:216990753-216990775 CAGGGAAGTCAGGCAGTTTAGGG - Intergenic
946848379 2:223881356-223881378 CAGGGTATCCACTCAGTTACTGG + Intronic
946973382 2:225120515-225120537 CAGGGTAGGCAGGCAGAGGAAGG - Intergenic
947295188 2:228623072-228623094 CAGGTTAGACAGGCAGTTGCTGG - Intergenic
947625390 2:231615227-231615249 CAGCATAGCCAGGCAATAGCTGG - Intergenic
947718534 2:232353694-232353716 GAGGCTGGACAGGCAGTTGCTGG - Intergenic
948338992 2:237233930-237233952 AAGGGAAGCCAGGAAGGTGCAGG + Intergenic
948715015 2:239855573-239855595 AAGGGTGGACAGGCAGTTGCTGG - Intergenic
1168796043 20:610536-610558 CTGGCTAGCCCGGCAGATGCTGG + Intergenic
1168874200 20:1159460-1159482 AAGGCTAGAAAGGCAGTTGCAGG - Intronic
1169325870 20:4676035-4676057 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1170927024 20:20734089-20734111 CAGGATGGCCAGGCAGTTCAGGG + Intergenic
1171320281 20:24237138-24237160 GAGGCTGGACAGGCAGTTGCTGG - Intergenic
1171391975 20:24807440-24807462 CAGAGGTGCCAGGCAGTTGAGGG + Intergenic
1171428484 20:25063756-25063778 GAAGGACGCCAGGCAGTTGCTGG - Intergenic
1172436016 20:34929453-34929475 CAGGGCTGCCAGGCCGTAGCAGG + Exonic
1172814912 20:37678673-37678695 CAGGGGAGAGAGGCAGTGGCAGG - Intergenic
1174338709 20:49882910-49882932 TAGGGCAGCCAGGCTGCTGCAGG - Intronic
1174450746 20:50618591-50618613 CAGGGTAAGCAGGCAGAGGCAGG - Intronic
1174888114 20:54358339-54358361 CAGGAGAGCCAGGGAGGTGCGGG + Intergenic
1175310162 20:58006322-58006344 CAGGGTGCCCAGGCAGTTTTTGG + Intergenic
1175702394 20:61149332-61149354 CAGGATGGGCAGGCAGCTGCCGG + Intergenic
1176249379 20:64113000-64113022 CAGAGTGGGCAGGCAGGTGCAGG + Intergenic
1176658645 21:9613232-9613254 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
1178473643 21:32917630-32917652 CAGGTTAGCCAAGGAGCTGCAGG - Intergenic
1178540018 21:33441518-33441540 AAGGTTAGACAGGCAGTTGTTGG + Intronic
1178659906 21:34498723-34498745 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
1179581650 21:42348098-42348120 CAGGGAAACCAGGCAGATGGTGG - Intronic
1180210019 21:46289843-46289865 AAGGTTAGACAGGCAGTTGCTGG + Intronic
1180259563 21:46659648-46659670 CAGGCTTGCCTGGCAGTGGCAGG + Intronic
1183688600 22:39375837-39375859 GAGGGAAGCCAGCCAGATGCAGG - Intronic
1183756309 22:39769522-39769544 CAGGGTAGCCTGGAAGTTGCAGG - Intronic
1183972201 22:41485990-41486012 GAGGGCAACCAGGCATTTGCAGG - Intronic
1184018265 22:41801988-41802010 GAGGTTGGACAGGCAGTTGCAGG + Intronic
1184168385 22:42743846-42743868 GAGGGAAGCCAGGAAGTGGCGGG + Intergenic
1184668561 22:46001202-46001224 CTGGAGAGCCAGGCAGATGCAGG + Intergenic
1184957839 22:47903766-47903788 AAGGTTGGACAGGCAGTTGCTGG + Intergenic
949145998 3:700874-700896 CTGGTTAGCCAGGGTGTTGCAGG + Intergenic
949749365 3:7333127-7333149 CAGGTTAGCCAGGGTGTTGCAGG - Intronic
951690972 3:25396374-25396396 CAGGTTAGCCAGGATGTTACAGG + Intronic
952183178 3:30941263-30941285 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
952827914 3:37539342-37539364 CAGGAAAGGAAGGCAGTTGCAGG + Intronic
952984832 3:38770081-38770103 CTGGTTAGCCAGGATGTTGCAGG + Intronic
953195730 3:40731544-40731566 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
953363288 3:42319891-42319913 AAGATTAGACAGGCAGTTGCTGG + Intergenic
953382263 3:42480741-42480763 CTGGTTAGCCAGGATGTTGCAGG - Intergenic
957538137 3:81532323-81532345 CAGGAGAGGCAGCCAGTTGCGGG - Intronic
960814469 3:121658667-121658689 GAGGCCAGCCAGGCAGTGGCTGG + Intronic
961400807 3:126641036-126641058 GAGGCTGGACAGGCAGTTGCTGG - Intronic
962146689 3:132847056-132847078 AAGGTTAGACAGGCAGTTGCTGG - Intergenic
962862134 3:139414239-139414261 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
963023550 3:140896876-140896898 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
963024626 3:140906918-140906940 CAGGTTGGACAGGCAGTTGCTGG + Intergenic
963171180 3:142252554-142252576 CTGGTTAGCCAGGATGTTGCAGG - Intergenic
963538559 3:146559061-146559083 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
964327773 3:155565563-155565585 CAGAGAAGCCAAGCAGATGCTGG + Intronic
964871394 3:161317189-161317211 AAGGTTAAACAGGCAGTTGCTGG - Intergenic
966553367 3:181230341-181230363 CTGGTTAGCCAGGACGTTGCAGG + Intergenic
968078893 3:195833385-195833407 GAGGTTAGCCAGGCAGAGGCTGG + Intergenic
968231515 3:197007517-197007539 CAGGGGAGGCGGGCAGGTGCTGG - Intronic
968704622 4:2072174-2072196 AGGGGCAGCCAGGCTGTTGCTGG + Exonic
968887894 4:3345169-3345191 AAGGTTGGACAGGCAGTTGCGGG + Intronic
969120275 4:4903521-4903543 CAGGGAAGCCAAGGGGTTGCTGG + Intergenic
969592542 4:8130225-8130247 CAGGGTGGCCAGGGTGGTGCTGG + Intronic
969666033 4:8558076-8558098 CAGGGTCCTCAGGCAGGTGCTGG - Intergenic
969860738 4:10033723-10033745 CAGGTCGGCCAGGCAGCTGCAGG - Intronic
970174935 4:13330223-13330245 CAGGGTGACCAGCCAGTTGCGGG + Intergenic
970797004 4:19924638-19924660 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
972239263 4:37172417-37172439 GAGGTTAGACAGGCAGTCGCTGG - Intergenic
974534338 4:63154998-63155020 CTGGTTAGCCAGGGTGTTGCAGG + Intergenic
976562736 4:86521134-86521156 CTGGTTAGCCAGGTTGTTGCAGG + Intronic
977542568 4:98335307-98335329 CAGGTTGGTCATGCAGTTGCTGG + Intronic
979256647 4:118613419-118613441 CAAGGAGGCCAGGGAGTTGCTGG + Intergenic
979331701 4:119427126-119427148 CAAGGAGGCCAGGGAGTTGCTGG - Intergenic
979878459 4:125924170-125924192 CAGGGTAGGCTGGCAGTTTGGGG + Intergenic
982049917 4:151490126-151490148 CTGGTTAGCCAGGGTGTTGCAGG - Intronic
982224998 4:153156958-153156980 CAGGGTGGGCAGGCAGGGGCGGG - Intronic
983661564 4:170134894-170134916 CTGGTTAGCCAGGGTGTTGCAGG + Intergenic
983776175 4:171609966-171609988 CTGGCTAGCCAGGATGTTGCAGG - Intergenic
983816243 4:172130141-172130163 CAGGTTGGACAGGCAGTTGTTGG + Intronic
985642189 5:1068900-1068922 CAGGGAGGCCAGGCAGTGCCAGG + Intronic
986469653 5:8061072-8061094 CAGGGAAGCGTGGCAGCTGCCGG - Intergenic
986518939 5:8593478-8593500 AAGGTTGGACAGGCAGTTGCTGG - Intergenic
986540441 5:8839618-8839640 CAGGGAAGCGTGGCAGCTGCCGG + Intergenic
987434874 5:17882918-17882940 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
988260694 5:28882932-28882954 CTGGTTAGCCAGGGTGTTGCAGG - Intergenic
988499975 5:31776361-31776383 CAGGGCAGGGAGGCAGTTGGAGG - Intronic
989525969 5:42454319-42454341 CTGGTTAGCCAGGATGTTGCAGG + Intronic
990005428 5:50939293-50939315 CTGGTTAGCCAGGGTGTTGCAGG - Intergenic
990768613 5:59216811-59216833 CAGGGTAGCCTTTCAGGTGCAGG - Intronic
991414666 5:66379777-66379799 CTGGTTAGCCAGGGTGTTGCAGG - Intergenic
992019821 5:72611385-72611407 CAGCGCAGAGAGGCAGTTGCTGG + Intergenic
992293807 5:75306917-75306939 AAGGTTGGACAGGCAGTTGCTGG - Intergenic
992701988 5:79350091-79350113 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
995797033 5:115952276-115952298 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
996723708 5:126654984-126655006 AAAGGTGGACAGGCAGTTGCAGG - Intergenic
997117397 5:131139808-131139830 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
997566970 5:134895449-134895471 CAGGTTAGGGAGGGAGTTGCGGG - Intronic
998703450 5:144731834-144731856 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
1002426697 5:179180943-179180965 CAGGGGAGCCAGGGAGAGGCAGG + Intronic
1002606071 5:180383484-180383506 CAGGGTCCCAAGGCAGCTGCTGG + Intergenic
1002980579 6:2132415-2132437 CTGGGAAGCCAGGCATTTCCTGG + Intronic
1004071603 6:12303304-12303326 GAGGCTAGACAGGCAGTTGCTGG - Intergenic
1005383098 6:25257560-25257582 CAGGGCAGCCAGGCAGGGCCTGG + Intergenic
1006767331 6:36519406-36519428 CAGGGGAGACAGGCAGATGAAGG - Intronic
1007438642 6:41838239-41838261 CTGGTTAGCCAGGATGTTGCAGG - Intronic
1007737305 6:43989825-43989847 CAGGGCAGCCTGGCAGTGCCGGG + Intergenic
1008250875 6:49238261-49238283 CTGGTTAGCCAGGGTGTTGCAGG + Intergenic
1008691407 6:53983361-53983383 CACAGAAGCCAAGCAGTTGCTGG - Intronic
1009191179 6:60631781-60631803 CAGGGCAACCAGGCAGGAGCAGG - Intergenic
1009838788 6:69040106-69040128 GAGGTTAGACAGACAGTTGCTGG + Intronic
1010781891 6:79953532-79953554 CAGGGGCGCTAGGCAGTTGGTGG + Intergenic
1010879461 6:81150140-81150162 CTGGTTAGCCAGGATGTTGCAGG - Intergenic
1011134559 6:84086303-84086325 CAGGTTGGACAGGCAGTTGCTGG + Intronic
1011589002 6:88952584-88952606 CTGGTTAGCCAGGATGTTGCAGG - Intronic
1012049076 6:94316655-94316677 TAGGGTAACCAGGCAGGTGGTGG + Intergenic
1012652249 6:101769933-101769955 GAGGTTAGACAGGCAGTTGCTGG + Intronic
1012796936 6:103774278-103774300 CAGGGGAGTCAGGCACTTCCAGG - Intergenic
1012965672 6:105670022-105670044 CTGGTTAGCCAGGGTGTTGCAGG - Intergenic
1013471387 6:110469398-110469420 AAAATTAGCCAGGCAGTTGCGGG + Intronic
1014420951 6:121245094-121245116 CTGGGTAGCCAGGGTGTTGCAGG - Intronic
1015046728 6:128785221-128785243 GAGGGTTGACAGCCAGTTGCTGG + Intergenic
1017295007 6:152783339-152783361 CAGGAGAGCCAGGCAGATGGTGG - Intergenic
1017985164 6:159437106-159437128 CTGGGGAGCCGGGCAGTGGCAGG + Intergenic
1018246849 6:161831984-161832006 CAAGACAGCCAGACAGTTGCTGG - Intronic
1018835737 6:167482440-167482462 CTGGCTAGGCAGGCAGGTGCGGG - Intergenic
1018920662 6:168170258-168170280 CGGGTTGGACAGGCAGTTGCTGG - Intergenic
1020332314 7:7032329-7032351 CTGGTTAGCCAGGATGTTGCGGG + Intergenic
1021475635 7:21057722-21057744 CAGAGTGTGCAGGCAGTTGCAGG - Intergenic
1021754909 7:23842667-23842689 CTGGCTAGCCAGGCTGTTGCAGG + Intergenic
1021869262 7:24987451-24987473 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
1022237461 7:28475761-28475783 CAGGGTAGCCAGGCACATATGGG + Intronic
1023398622 7:39774710-39774732 CAAGGAGGCCAGGGAGTTGCTGG + Intergenic
1023864748 7:44233386-44233408 CAGAGCAGCCAGGCCGTGGCTGG - Intronic
1024394490 7:48849917-48849939 CAGACTAGCCAGACAATTGCAGG - Intergenic
1024400776 7:48922724-48922746 CAGACTAGCCAGACAATTGCAGG + Intergenic
1024470223 7:49761789-49761811 GAGGCTGGACAGGCAGTTGCTGG + Intergenic
1024616932 7:51123692-51123714 CAGGGAAGTCATGCATTTGCTGG - Intronic
1024677025 7:51646149-51646171 GAGGGGAGACAGGCAGGTGCAGG + Intergenic
1025149987 7:56540223-56540245 CAGGGAAGCCAGGCAGTGTCAGG + Intergenic
1026064645 7:67059505-67059527 GAGGGTAGGCTGGCAGTTGCTGG + Intronic
1026150036 7:67780166-67780188 CAGGGAAGCCAGACAGGTACAGG - Intergenic
1026712826 7:72757824-72757846 AAGGTTGGACAGGCAGTTGCTGG - Intronic
1026713653 7:72767200-72767222 GAGGGTAGGCTGGCAGTTGCTGG - Intronic
1029311802 7:99674186-99674208 AAGGTTGGACAGGCAGTTGCTGG - Intronic
1029316671 7:99721946-99721968 AAGGTTGGACAGGCAGTTGCTGG - Intronic
1029322564 7:99777676-99777698 AAGGTTGGACAGGCAGTTGCTGG - Intronic
1029328163 7:99827708-99827730 GAGGTTGGACAGGCAGTTGCTGG + Intergenic
1029409267 7:100398379-100398401 GAGGGGAGCCAGGCAGAGGCTGG - Intronic
1029457268 7:100677638-100677660 CAGTGTGGCCAGGCAGCTCCCGG - Exonic
1029734991 7:102460700-102460722 CAAGGTAGTCAGGCAGTTTGGGG - Intronic
1030412348 7:109197362-109197384 AAGGCTGGACAGGCAGTTGCTGG + Intergenic
1032419074 7:131763297-131763319 GAGGTTAAACAGGCAGTTGCTGG - Intergenic
1033344380 7:140515906-140515928 GAGGCTGGACAGGCAGTTGCTGG + Intergenic
1033598231 7:142871324-142871346 CAGGGCACCCAGGCAGGTGCAGG - Exonic
1033723078 7:144083038-144083060 CAGGGAAGCCACGCAGTTCTGGG - Intergenic
1034392467 7:150797562-150797584 AGGGTTAGACAGGCAGTTGCTGG + Intronic
1034700314 7:153089579-153089601 GAGGCTGGACAGGCAGTTGCAGG + Intergenic
1035017976 7:155782783-155782805 CAGGCCATCCAGGCAGGTGCGGG + Intergenic
1035136597 7:156709326-156709348 CTGGTTAGCCAGGATGTTGCAGG - Intronic
1035202006 7:157273661-157273683 CAGGCCAGGCAGGCACTTGCTGG - Intergenic
1035410184 7:158633664-158633686 CTGCTGAGCCAGGCAGTTGCTGG - Intronic
1035927644 8:3745668-3745690 CGGGGAAGTCAGGCAGCTGCTGG + Intronic
1036922864 8:12874427-12874449 CAGGGAATCCAGGCTGTTGAGGG + Intergenic
1037690482 8:21177521-21177543 CAGGGTAGCGAAGCAGCTGATGG - Intergenic
1037769229 8:21789223-21789245 CGGGGGAGCCAGTCAGTTTCCGG - Intronic
1040959413 8:53015341-53015363 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1040989549 8:53335442-53335464 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
1041763617 8:61393922-61393944 CTGGTTAGCCAGGATGTTGCAGG + Intronic
1041798992 8:61777655-61777677 GAGGTTAGACAGGCAGATGCTGG + Intergenic
1042608035 8:70565931-70565953 CTGGTTAGCCAGGATGTTGCAGG - Intergenic
1043442306 8:80287056-80287078 CATGGCACCCAGGCAGGTGCAGG - Intergenic
1043443663 8:80299053-80299075 CATGGCACCCAGGCAGGTGCAGG - Intergenic
1043909991 8:85852989-85853011 AAGGTTGGACAGGCAGTTGCTGG + Intergenic
1043920309 8:85975031-85975053 AAAGGTACCCAGGCAGTTACAGG + Intergenic
1046015499 8:108599659-108599681 CACGGTATCCAGGAAGTTGGAGG - Intergenic
1046033851 8:108817256-108817278 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
1046293226 8:112189719-112189741 CAGAGTAGCCAAGTAGATGCTGG - Intergenic
1046448739 8:114359336-114359358 CTGGTTAGCCAGGATGTTGCAGG - Intergenic
1047227289 8:122967669-122967691 CTGGTTAGCCAGGATGTTGCAGG + Intronic
1047936705 8:129787744-129787766 AAGGTTAGACAGGCAGTTGGTGG + Intergenic
1047957227 8:129985110-129985132 CAGGGTTGCCACTCAGTAGCTGG + Intronic
1049743175 8:144250648-144250670 CAGAGCAGCCAGGCAGTTTTGGG - Intronic
1049794414 8:144489975-144489997 CGAGGGAGCCAGGCAGATGCTGG - Intronic
1049809032 8:144555037-144555059 CAGGATATCCAGGCAGAGGCAGG - Intronic
1049893484 9:92748-92770 CAGGCTGGACAGGCAGTTGTTGG + Intergenic
1051329595 9:16010363-16010385 CAGGCTAGCCAGGATTTTGCAGG + Intronic
1051881219 9:21841396-21841418 CTGGTTAGCCAGGATGTTGCAGG - Intronic
1052470900 9:28895450-28895472 GAGGGTGGACAGGCAGTTTCTGG - Intergenic
1053064942 9:35061522-35061544 CAGTGTCTCTAGGCAGTTGCTGG - Intronic
1053734703 9:41092816-41092838 CAGGTTGGACAGGCAGTTGTTGG + Intergenic
1054693677 9:68338581-68338603 CAGGTTGGACAGGCAGTTGTTGG - Intronic
1054830257 9:69617078-69617100 GAGGTTGGACAGGCAGTTGCTGG - Intronic
1055465235 9:76558936-76558958 CCAGGTAGCCTGGCAGATGCTGG + Intergenic
1056213060 9:84382929-84382951 CAGGCTGGACAAGCAGTTGCTGG - Intergenic
1056309490 9:85324631-85324653 CTGGTTAGCCAGGGTGTTGCAGG - Intergenic
1058033713 9:100227796-100227818 AAGGTTGGACAGGCAGTTGCTGG - Intronic
1058154484 9:101499597-101499619 GAGGTTGGACAGGCAGTTGCTGG + Intronic
1060483264 9:124030311-124030333 CTGGGAAGACAGGCAGATGCAGG + Intronic
1061381783 9:130263140-130263162 CCAGGTAGCCAGGCTGTTTCAGG + Intergenic
1061740212 9:132697982-132698004 GAGGTTGGACAGGCAGTTGCTGG - Intergenic
1062034813 9:134378287-134378309 CTGGGGAGCCAGGCCGGTGCTGG + Intronic
1062041951 9:134408334-134408356 CAGGGTTGTCAGGCCATTGCAGG + Intronic
1062190699 9:135246480-135246502 CAGGGTAGCCACGAAGTTCAAGG + Intergenic
1062424611 9:136500335-136500357 CAGGGAAGTCAGGCAGAGGCGGG - Intronic
1062707135 9:137951998-137952020 GAGTGTTGCCAGGCAGTGGCTGG + Intronic
1203636372 Un_KI270750v1:116811-116833 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
1187180288 X:16937682-16937704 AAGTTTAGACAGGCAGTTGCTGG - Intergenic
1190512057 X:51182948-51182970 CTGGTTAGCCAGGCTGGTGCTGG - Intergenic
1191677715 X:63809253-63809275 CAGGGTAGCCAGGCAGTTGCTGG - Intergenic
1191784488 X:64903228-64903250 CTGGTTAGCCAGGACGTTGCAGG + Intergenic
1191934069 X:66407491-66407513 CCTGGTAGCCAAGCAGTTGCCGG - Intergenic
1192853414 X:74981412-74981434 CTGGTTAGCCAGGGTGTTGCAGG - Intergenic
1193924147 X:87464698-87464720 CTGGTTAGCCAGGATGTTGCAGG - Intergenic
1194278272 X:91913870-91913892 CTGGTTAGCCAGGATGTTGCAGG - Intronic
1194353798 X:92855869-92855891 CTGGTTAGCCAGGGTGTTGCAGG - Intergenic
1194384490 X:93236417-93236439 CTGGTTAGCCAGGATGTTGCAGG - Intergenic
1194553838 X:95333188-95333210 CTGGTTAGCCAGGATGTTGCAGG - Intergenic
1194815852 X:98440256-98440278 CTGGTTAGCCAGGATGTTGCAGG - Intergenic
1196362856 X:114887177-114887199 GAGGTTAGACAGGTAGTTGCTGG + Intronic
1196599449 X:117585056-117585078 CTGGTTAGCCAGGGTGTTGCAGG + Intergenic
1196798189 X:119519211-119519233 GAGGCTGGACAGGCAGTTGCTGG + Intergenic
1197472153 X:126877354-126877376 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
1197603778 X:128560936-128560958 CTGGTTAGCCAGGGTGTTGCAGG - Intergenic
1197936055 X:131741427-131741449 CAGGATCGCCTGGCAGCTGCTGG - Intergenic
1198517988 X:137427817-137427839 CAGGGTAGCCAGGGCATTGTTGG - Intergenic
1198770276 X:140123541-140123563 CTGGTTAGCCAGGATGTTGCAGG + Intergenic
1200595609 Y:5135946-5135968 CTGGTTAGCCAGGATGTTGCAGG - Intronic
1200662158 Y:5972941-5972963 CTGGTTAGCCAGGGTGTTGCAGG - Intergenic