ID: 1191683729

View in Genome Browser
Species Human (GRCh38)
Location X:63867705-63867727
Sequence GACTCAGTTGGTGGCCATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191683729_1191683734 28 Left 1191683729 X:63867705-63867727 CCTAAATGGCCACCAACTGAGTC No data
Right 1191683734 X:63867756-63867778 GATGCGTAATGTAAAGTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191683729 Original CRISPR GACTCAGTTGGTGGCCATTT AGG (reversed) Intergenic
No off target data available for this crispr