ID: 1191683734

View in Genome Browser
Species Human (GRCh38)
Location X:63867756-63867778
Sequence GATGCGTAATGTAAAGTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191683733_1191683734 6 Left 1191683733 X:63867727-63867749 CCTGGAAAATAGTTAAAATATTT No data
Right 1191683734 X:63867756-63867778 GATGCGTAATGTAAAGTATTTGG No data
1191683729_1191683734 28 Left 1191683729 X:63867705-63867727 CCTAAATGGCCACCAACTGAGTC No data
Right 1191683734 X:63867756-63867778 GATGCGTAATGTAAAGTATTTGG No data
1191683732_1191683734 16 Left 1191683732 X:63867717-63867739 CCAACTGAGTCCTGGAAAATAGT No data
Right 1191683734 X:63867756-63867778 GATGCGTAATGTAAAGTATTTGG No data
1191683731_1191683734 19 Left 1191683731 X:63867714-63867736 CCACCAACTGAGTCCTGGAAAAT No data
Right 1191683734 X:63867756-63867778 GATGCGTAATGTAAAGTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191683734 Original CRISPR GATGCGTAATGTAAAGTATT TGG Intergenic
No off target data available for this crispr