ID: 1191688941

View in Genome Browser
Species Human (GRCh38)
Location X:63920495-63920517
Sequence CCACCACCTGCAGTCTCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191688938_1191688941 -2 Left 1191688938 X:63920474-63920496 CCTTGATGGCTTGATTTGCACCC No data
Right 1191688941 X:63920495-63920517 CCACCACCTGCAGTCTCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191688941 Original CRISPR CCACCACCTGCAGTCTCCTT AGG Intergenic
No off target data available for this crispr