ID: 1191692033

View in Genome Browser
Species Human (GRCh38)
Location X:63950206-63950228
Sequence GGGGCCTGGTTGGGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191692025_1191692033 5 Left 1191692025 X:63950178-63950200 CCAGTGGGCAGGCACCATTCAAT No data
Right 1191692033 X:63950206-63950228 GGGGCCTGGTTGGGAAAAACAGG No data
1191692029_1191692033 -9 Left 1191692029 X:63950192-63950214 CCATTCAATAAGCTGGGGCCTGG No data
Right 1191692033 X:63950206-63950228 GGGGCCTGGTTGGGAAAAACAGG No data
1191692024_1191692033 6 Left 1191692024 X:63950177-63950199 CCCAGTGGGCAGGCACCATTCAA No data
Right 1191692033 X:63950206-63950228 GGGGCCTGGTTGGGAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191692033 Original CRISPR GGGGCCTGGTTGGGAAAAAC AGG Intergenic
No off target data available for this crispr