ID: 1191692591

View in Genome Browser
Species Human (GRCh38)
Location X:63956321-63956343
Sequence GTATACTGCTTGGGTAATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191692585_1191692591 -5 Left 1191692585 X:63956303-63956325 CCACAAACTGGATGTTGTGTATA No data
Right 1191692591 X:63956321-63956343 GTATACTGCTTGGGTAATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191692591 Original CRISPR GTATACTGCTTGGGTAATGG GGG Intergenic
No off target data available for this crispr