ID: 1191699086

View in Genome Browser
Species Human (GRCh38)
Location X:64020292-64020314
Sequence GCCATTTCACGGGTGTGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191699082_1191699086 -10 Left 1191699082 X:64020279-64020301 CCTATAACCATCTGCCATTTCAC No data
Right 1191699086 X:64020292-64020314 GCCATTTCACGGGTGTGCTTAGG No data
1191699080_1191699086 5 Left 1191699080 X:64020264-64020286 CCTGGGTTTGCCTGACCTATAAC No data
Right 1191699086 X:64020292-64020314 GCCATTTCACGGGTGTGCTTAGG No data
1191699079_1191699086 11 Left 1191699079 X:64020258-64020280 CCTCTGCCTGGGTTTGCCTGACC No data
Right 1191699086 X:64020292-64020314 GCCATTTCACGGGTGTGCTTAGG No data
1191699075_1191699086 30 Left 1191699075 X:64020239-64020261 CCCTAGGTTAATGCTTTCTCCTC No data
Right 1191699086 X:64020292-64020314 GCCATTTCACGGGTGTGCTTAGG No data
1191699076_1191699086 29 Left 1191699076 X:64020240-64020262 CCTAGGTTAATGCTTTCTCCTCT No data
Right 1191699086 X:64020292-64020314 GCCATTTCACGGGTGTGCTTAGG No data
1191699081_1191699086 -5 Left 1191699081 X:64020274-64020296 CCTGACCTATAACCATCTGCCAT No data
Right 1191699086 X:64020292-64020314 GCCATTTCACGGGTGTGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191699086 Original CRISPR GCCATTTCACGGGTGTGCTT AGG Intergenic
No off target data available for this crispr