ID: 1191701623

View in Genome Browser
Species Human (GRCh38)
Location X:64048154-64048176
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191701623_1191701625 6 Left 1191701623 X:64048154-64048176 CCAGGGTTATATGGAAAGAACTC No data
Right 1191701625 X:64048183-64048205 CTCCCTTGGATGAAGACCAGAGG No data
1191701623_1191701624 -8 Left 1191701623 X:64048154-64048176 CCAGGGTTATATGGAAAGAACTC No data
Right 1191701624 X:64048169-64048191 AAGAACTCTGATCTCTCCCTTGG No data
1191701623_1191701629 11 Left 1191701623 X:64048154-64048176 CCAGGGTTATATGGAAAGAACTC No data
Right 1191701629 X:64048188-64048210 TTGGATGAAGACCAGAGGGAAGG No data
1191701623_1191701631 13 Left 1191701623 X:64048154-64048176 CCAGGGTTATATGGAAAGAACTC No data
Right 1191701631 X:64048190-64048212 GGATGAAGACCAGAGGGAAGGGG No data
1191701623_1191701626 7 Left 1191701623 X:64048154-64048176 CCAGGGTTATATGGAAAGAACTC No data
Right 1191701626 X:64048184-64048206 TCCCTTGGATGAAGACCAGAGGG No data
1191701623_1191701632 16 Left 1191701623 X:64048154-64048176 CCAGGGTTATATGGAAAGAACTC No data
Right 1191701632 X:64048193-64048215 TGAAGACCAGAGGGAAGGGGTGG No data
1191701623_1191701630 12 Left 1191701623 X:64048154-64048176 CCAGGGTTATATGGAAAGAACTC No data
Right 1191701630 X:64048189-64048211 TGGATGAAGACCAGAGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191701623 Original CRISPR GAGTTCTTTCCATATAACCC TGG (reversed) Intergenic