ID: 1191701624

View in Genome Browser
Species Human (GRCh38)
Location X:64048169-64048191
Sequence AAGAACTCTGATCTCTCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191701617_1191701624 18 Left 1191701617 X:64048128-64048150 CCCAGTGGGAATTTCAGCAACTC No data
Right 1191701624 X:64048169-64048191 AAGAACTCTGATCTCTCCCTTGG No data
1191701622_1191701624 -4 Left 1191701622 X:64048150-64048172 CCAGCCAGGGTTATATGGAAAGA No data
Right 1191701624 X:64048169-64048191 AAGAACTCTGATCTCTCCCTTGG No data
1191701623_1191701624 -8 Left 1191701623 X:64048154-64048176 CCAGGGTTATATGGAAAGAACTC No data
Right 1191701624 X:64048169-64048191 AAGAACTCTGATCTCTCCCTTGG No data
1191701618_1191701624 17 Left 1191701618 X:64048129-64048151 CCAGTGGGAATTTCAGCAACTCC No data
Right 1191701624 X:64048169-64048191 AAGAACTCTGATCTCTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191701624 Original CRISPR AAGAACTCTGATCTCTCCCT TGG Intergenic
No off target data available for this crispr