ID: 1191701624 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | X:64048169-64048191 |
| Sequence | AAGAACTCTGATCTCTCCCT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1191701617_1191701624 | 18 | Left | 1191701617 | X:64048128-64048150 | CCCAGTGGGAATTTCAGCAACTC | No data | ||
| Right | 1191701624 | X:64048169-64048191 | AAGAACTCTGATCTCTCCCTTGG | No data | ||||
| 1191701622_1191701624 | -4 | Left | 1191701622 | X:64048150-64048172 | CCAGCCAGGGTTATATGGAAAGA | No data | ||
| Right | 1191701624 | X:64048169-64048191 | AAGAACTCTGATCTCTCCCTTGG | No data | ||||
| 1191701623_1191701624 | -8 | Left | 1191701623 | X:64048154-64048176 | CCAGGGTTATATGGAAAGAACTC | No data | ||
| Right | 1191701624 | X:64048169-64048191 | AAGAACTCTGATCTCTCCCTTGG | No data | ||||
| 1191701618_1191701624 | 17 | Left | 1191701618 | X:64048129-64048151 | CCAGTGGGAATTTCAGCAACTCC | No data | ||
| Right | 1191701624 | X:64048169-64048191 | AAGAACTCTGATCTCTCCCTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1191701624 | Original CRISPR | AAGAACTCTGATCTCTCCCT TGG | Intergenic | ||