ID: 1191701626

View in Genome Browser
Species Human (GRCh38)
Location X:64048184-64048206
Sequence TCCCTTGGATGAAGACCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191701622_1191701626 11 Left 1191701622 X:64048150-64048172 CCAGCCAGGGTTATATGGAAAGA No data
Right 1191701626 X:64048184-64048206 TCCCTTGGATGAAGACCAGAGGG No data
1191701623_1191701626 7 Left 1191701623 X:64048154-64048176 CCAGGGTTATATGGAAAGAACTC No data
Right 1191701626 X:64048184-64048206 TCCCTTGGATGAAGACCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191701626 Original CRISPR TCCCTTGGATGAAGACCAGA GGG Intergenic
No off target data available for this crispr