ID: 1191701629

View in Genome Browser
Species Human (GRCh38)
Location X:64048188-64048210
Sequence TTGGATGAAGACCAGAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191701622_1191701629 15 Left 1191701622 X:64048150-64048172 CCAGCCAGGGTTATATGGAAAGA No data
Right 1191701629 X:64048188-64048210 TTGGATGAAGACCAGAGGGAAGG No data
1191701623_1191701629 11 Left 1191701623 X:64048154-64048176 CCAGGGTTATATGGAAAGAACTC No data
Right 1191701629 X:64048188-64048210 TTGGATGAAGACCAGAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191701629 Original CRISPR TTGGATGAAGACCAGAGGGA AGG Intergenic
No off target data available for this crispr