ID: 1191701631

View in Genome Browser
Species Human (GRCh38)
Location X:64048190-64048212
Sequence GGATGAAGACCAGAGGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1191701623_1191701631 13 Left 1191701623 X:64048154-64048176 CCAGGGTTATATGGAAAGAACTC No data
Right 1191701631 X:64048190-64048212 GGATGAAGACCAGAGGGAAGGGG No data
1191701622_1191701631 17 Left 1191701622 X:64048150-64048172 CCAGCCAGGGTTATATGGAAAGA No data
Right 1191701631 X:64048190-64048212 GGATGAAGACCAGAGGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1191701631 Original CRISPR GGATGAAGACCAGAGGGAAG GGG Intergenic
No off target data available for this crispr